Published by
Stanford Medicine

Category

Genetics

Cancer, Genetics, Medicine and Society, Research, Stanford News, Women's Health

Screening could slash number of breast cancer cases

Screening could slash number of breast cancer cases

dna-163466_1280Should every newborn baby girl be genetically screened to prevent breast cancer? Obviously, that isn’t cost-effective — yet. But if it were, would it be worthwhile?

A previous study said no. But research published today in Cancer Epidemiology, Biomarkers & Prevention by Stanford researchers suggests otherwise.

Led by senior author Alice Whittemore, PhD, the team examined 86 gene variants known to increase the chances of breast cancer. They created a model that accounted for the prevalence of each variant and the associated risk of breast cancer. Each possible genome was then ranked by the likelihood of developing breast cancer within a woman’s lifetime.

“It was quite a computational feat,” Whittemore told me.

Working with Weiva Sieh, MD, PhD; Joseph Rothstein, PhD; and Valerie McGuire, PhD, the team found that women whose genomes ranked within the top 25 percent of risk include 50 percent of all future breast cancers. Those women would then have the opportunity to get regular mammograms, watch their diets and make childbearing and breast-feeding decisions with the awareness of their higher risk. Some women might even select, as Angelina Jolie did quite publicly, to have their breasts removed.

“The main takeaway message is we can be more optimistic than previously predicted about the value of genomic sequencing,” Whittemore said. “But we still have a way to go in preventing the disease.”

“Our ability to predict the probability of disease based on genetics is the starting point,” Sieh said. “If a girl knew, from birth, what her inborn risk was, she could then make more informed choices to alter her future risk by altering her lifestyle factors. We also need better screening methods and preventative interventions with fewer side effects.”

“We want to focus on those at the highest risk,” Whittemore said.

Previously: Despite genetic advances, detection still key in breast cancer, NIH Director highlights Stanford research on breast cancer surgery choices  and Breast cancer awareness: Beneath the pink packaging 
Photo by PublicDomainPictures

Biomed Bites, Genetics, Research, Stanford News, Videos

DNA architecture fascinates Stanford researcher – and dictates biological outcomes

DNA architecture fascinates Stanford researcher - and dictates biological outcomes

It’s time for the next edition of Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces Scope readers to groundbreaking researchers in a variety of disciplines. 

It’s a puzzle that would delight puzzle master Will Shortz: How do you pack 2 meters of DNA into a container (the nucleus) only .000005 meters wide? Precisely, and according to plan, it seems. Stanford biophysicist Will Greenleaf, PhD, studies the architecture of the genome, building on the knowledge that DNA’s shape effects how a gene is expressed.

In the video above, Greenleaf, now an assistant professor of genetics, explains: “The genes have to be unpacked to be expressed. The mechanics of that are really fascinating.”

Greenleaf is a physics guy, earning a PhD in applied physics at Stanford to build on his undergraduate Harvard physics degree. He has also studied computer science and chemistry, bringing all of this knowledge to bear on demystifying the structure of DNA, and its RNA offshoots. Greenleaf and his team also develop new instruments needed to measure, see and manipulate DNA structure.

This is important for many reasons, but most directly to treat chromatinopathies, or diseases caused by the improper folding or structure of DNA and its associated proteins.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Caught in the act! Fast, cheap, high-resolution, easy way to tell which genes a cell is using, “Housekeeping” protein complex mutated in about 1/5 of all human cancers, say Stanford researchers and Mob science: Video game, EteRNA, lets amateurs advance RNA research

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Genetics, In the News, Research, Science

Zebrafish: A must-have for biomedical labs

4513641306_b5b4de7979_z-2

Rats, mice and fruit flies be warned: The hippest lab critter around is a striped, little fish from South Asia called the zebrafish.

The fishies’ popularity is skyrocketing, as Susannah Locke recently wrote for Vox:

Zebrafish breed quickly, scientists can manipulate their genes easily, and the fish actually share a surprising number of similarities with humans.

As a result, researchers can study zebrafish to better understand how things like metabolism, birth defects, and even cancer work — and the results are often applicable to humans. So, for instance, it’s relatively quick and easy to test certain drugs on zebrafish. If those experiments yield promising results, the scientists can then do more targeted experiments with rodents. And then maybe, finally, with people.

Zebrafish have some unique characteristics that can be useful too: Zebrafish can regenerate heart, retina, spinal cord and fin tissue. Scientists are probing this ability to improve healing and potentially even cultivate new tissues. Their embryos are also transparent, allowing scientists to study organ development in real-time.

Scientists have grown quite masterful at manipulating their genes. As Locke writes: “Over the past five years, the cost of modifying a single gene in a zebrafish has dropped from $10,000 down to about $100.” That’s part of the reason why more than 2,000 biomedical papers are written each year using the fish.

Joseph Schech, DVM, knows these animals well:

“They’re very hardy. They’re very forgiving,” says Schech, a laboratory veterinarian in charge of roughly 200,000 zebrafish (and several other species) at the National Institutes of Health. ”They are very adaptable in the wild. They live in clear mountain streams. They live in muddy rice paddies. They can do a wide range of temperature if they have time to adapt to it.”

He’s in charge of keeping the creatures healthy in a NIH zebrafish facility that’s currently used by some 21 different laboratories. It’s one of the largest zebrafish facilities in the world — a single 78–80°F room that holds about 10,000 small tanks with a total of roughly 200,000 fish. The zebrafish eat a diet of brine shrimp grown in a nearby room and can be trained to spawn on cue.

Numerous Stanford labs use zebrafish for all sorts of research: William Talbot, PhD, is examining the development of the vertebrate nervous system; Gill Bejerano, PhD, is probing its genetics; and James Chen, PhD, is looking at its ability to regenerate tissue, to name just a few.

Previously: Researchers capture detailed three-dimensional images of cardiac dynamics in zebrafish, The importance of the zebrafish in biomedicineCellular-level video of brain activity in a zebrafish and A very small fish with very big potential
Image by Bob Jenkins

Clinical Trials, Ethics, Genetics, NIH, Pediatrics

The promise and peril of genome sequencing newborns

NICUEven though doctors and researchers have made great strides in caring for patients in the past few decades, there are still many illnesses that are difficult to diagnose, let alone treat. Among the most heartbreaking cases are those newborns who come down with mysterious illnesses that defy medical expertise. But in recent years, doctors have turned to genetic sequencing in some of these cases to identify the culprit causes of the illnesses.

Last year, the National Institutes of Health funded four pilot projects looking into the efficacy and ethics of genetic screening for otherwise inexplicable illnesses in newborns. The first of the trials will begin next week at Children’s Mercy Hospital in Kansas City, Missouri, as reported in a recent story from Nature. The trial at Children’s Mercy Hospital will focus on rapid genome sequencing with a 24-hour turn-around. Genetic sequencing normally takes weeks, but some of these infants don’t survive that long. Doctors have used similar rapid genome sequencing to diagnose an infant with cardiac defects at Lucile Packard Children’s Hospital Stanford.

Earlier this year, I had the opportunity to report on a rare genetic mutation that leads young infants to develop inflammatory bowel disease. I spoke with some parents of children with the mutation, which was identified by sequencing the children’s exome – just the protein-producing part of the genome – as part of a new project (separate from the NIH trials) at the University of Toronto in Canada. As I explain in the piece, getting a bone marrow transplant early enough can help alleviate symptoms and save the child’s life.

The parents were uniformly grateful for the sequencing technology that made it possible to understand what was causing their baby’s illness, even in cases where the child didn’t survive long after diagnosis. One mother mentioned that realizing some of the best doctors in the country didn’t know what was ailing her daughter made the experience even more frightening. After months of worried confusion about their young children’s deteriorating health, for these parents to have an answer was a relief.

But because the technique is so new, several ethical details still need clarification – which the NIH study hopes to answer. From the Nature news story:

Misha Angrist, a genomic-policy expert at Duke University in Durham, North Carolina, says that although the 24-hour genome process is impressive, it is not clear whether genomic sequencing of newborns will soon become standard practice. Many questions remain about who will pay for sequencing, who should have access to the data and how far clinicians should go in extracting genome information that is unrelated to the disease at hand. Then there is the question of how informative the process is. “I think it’s really important that we do these experiments so that we start to see what that yield is,” Angrist says.

All four teams will include an ethicist who will be responsible for dealing with questions like the ones Angrist raises. The other three trials at Boston Children’s Hospital, the University of North Carolina in Chapel Hill, and at the University of California, San Francisco are still awaiting approval from the Federal Drug Adminstration.

Previously: Stanford patient on having her genome sequenced: “This is the right thing to do for our family” When ten days = a lifetime: Rapid whole-genome sequencing helps critically ill newborn Assessing the challenges and opportunities when bringing whole-genome sequencing to the bedside Whole genome sequencing: The known knowns and the unknown unknowns
Photo by kqedquest

Cancer, Genetics, Stanford News, Videos, Women's Health

Despite genetic advances, detection still key in breast cancer

Despite genetic advances, detection still key in breast cancer

Just a few years before the launch of the first national breast cancer awareness month, I found a small lump in my left breast. I still remember the cold chill that ran through me – and stayed with me until several days later when a surgeon discovered that the lump was not a tumor. His parting words have never left me: “Remember how you’ve been feeling.” He wanted to make sure I would go on to have regular mammograms.

Spreading the word about the disease and the importance of detecting it in its early stages was – and is – the point of the national awareness campaign. In the almost 30 years since that first campaign, advances in imaging technology have enabled earlier detection of breast cancer, genome sequencing has identified some of the mysteries behind the development risk, and selecting the most effective surgery and chemotherapy is more and more of an individualized choice.

Stanford has a powerful team of physicians addressing all aspects of breast cancer science and care. On Oct. 16, breast-imaging specialist Jafi Lipson, MD, assistant professor of radiology, and breast cancer surgeon Amanda Wheeler, MD, clinical assistant professor of surgery, will give a free lecture, “The Latest Advancements in Screening and Treatment for Breast Cancer,” at the Sheraton Palo Alto. And throughout the month, Stanford Health Care will post short educational videos and infographics on a variety of breast-cancer topics, including types of breast cancer, options in surgical reconstruction, and why enduring the pain of compression in mammography is worth the effort. Today, Stanford Health Care kicks off the month with a video featuring Stanford breast cancer expert Alison Kurian, MD, explaining the role that genetics play in disease development (above).

Because one in eight women will develop breast cancer in her lifetime, I would urge all of us to keep in mind the reality of this disease – and to honor those we know who have survived, or not, by paying attention.

Previously: NIH Director highlights Stanford research on breast cancer surgery choicesBreast cancer patients are getting more bilateral mastectomies —  but not any survival benefitBreast cancer awareness: Beneath the pink packaging and At Stanford event, cancer advocate Susan Love talks about “a future with no breast cancer”

Applied Biotechnology, Genetics, In the News, Nutrition, Public Health, Research

“Frankenfoods” just like natural counterparts, health-wise (at least if you’re a farm animal)

"Frankenfoods" just like natural counterparts, health-wise (at least if you're a farm animal)

cow2More than a hundred billion farm animals have voted with their feet (or their hoofs, as the case may be). And the returns are in: Genetically modified meals are causing them zero health problems.

Many a word has been spilled in connection with the scientific investigation of crops variously referred to as “transgenic,” “bioengineered,” “genetically engineered” or “genetically modified.” In every case, what’s being referred to is an otherwise ordinary fruit, vegetable, or fiber source into which genetic material from a foreign species has been inserted for the purpose of making that crop, say, sturdier or  more drought- or herbicide- or pest-resistant.

Derided as “Frankenfoods” by critics, these crops have been accused of everything from being responsible for a very real global uptick in allergic diseases to causing cancer and autoimmune disease. But (flying in the face of the first accusation) allergic disorders are also rising in Europe, where genetically modified, or GM, crops’ usage is far less widespread than in North America. It’s the same story with autoimmune disease. And claims of a link between genetically modified crops and tumor formation have been backed by scant if any evidence; one paper making such a claim  got all the way through peer review and received a fair amount of Internet buzz before it was ignominiously retracted last year.

But a huge natural experiment to test GM crops’ safety has been underway for some time. Globally, between 70 and 90 percent of all GM foods are consumed by domesticated animals grown by farmers and ranchers. More than 95 percent of such animals – close to 10 billion of them – in the United States alone consume feed containing GM  components.

This was, of course, not the case before the advent of commercially available GM feeds in the 1990s. And U.S. law has long required scrupulous record-keeping concerning the health of animals grown for food production. This makes possible a before-and-after comparison.

In a just-published article in the Journal of Animal Science, University of California-Davis scientists performed a massive review of data available on performance and health of animals consuming feed containing GM ingredients and  products derived from them. The researchers conclude that there’s no evidence of GM products exerting negative health effects on livestock. From the study’s abstract:

Numerous experimental studies have consistently revealed that the performance and health of GE-fed animals are comparable with those fed [otherwise identical] non-[GM] crop lines. Data on livestock productivity and health were collated from publicly available sources from 1983, before the introduction of [GM] crops in 1996, and subsequently through 2011, a period with high levels of predominately [GM] animal feed. These field data sets representing over 100 billion animals following the introduction of [GM]crops did not reveal unfavorable or perturbed trends in livestock health and productivity. No study has revealed any differences in the nutritional profile of animal products derived from[GM]-fed animals.

In other words, the 100 billion GM-fed animals didn’t get sick any more frequently, or in different ways. No noticeable difference at all.

Should that surprise us? We humans are, in fact, pretty transgenic ourselves. About 5 percent of our own DNA can be traced to viruses who deposited their  genes in our genomes, leaving them behind as reminders of the viral visitations. I suppose that’s a great case against cannibalism if you fear GM foods. But I can think of other far more valid arguments to be made along those lines.

Previously: Ask Stanford Medicine: Pediatric immunologist answers your questions about food allergy research, Research shows little evidence that organic foods are more nutritional than conventional ones and Stanford study on the health benefits of organic food: What people are saying
Photo by David B. Gleason

Cardiovascular Medicine, Genetics, Research, Science, Stanford News, Stem Cells

Stem cell study explains how mutation common in Asians affects heart health

Stem cell study explains how mutation common in Asians affects heart health

10011881004_d5ab6d7cd9_zMany Asians carry a mutation that causes their faces to flush when they drink alcohol. The affected gene is called ALDH2, and it also plays a role in cardiovascular health. Carriers are more susceptible to coronary artery disease and tend to recover more poorly than non-carriers from the damage caused by a heart attack. Now Stanford cardiologist Joseph Wu, MD, PhD, and postdoctoral scholar Antje Ebert, PhD, have learned why.

The researchers used a type of stem cell called an induced pluripotent stem cell, or iPS cell, to conduct the study. The stem cells are made from easily obtained tissue like skin, and they can be coaxed in the laboratory to become other types of tissue, like heart muscle cells. It’s one of the first times iPS cells have been used to examine ethnic-specific differences among populations. The research was published yesterday in Science Translational Medicine.

From our release:

The study showed that the ALDH2 mutation affects heart health by controlling the survival decisions cells make during times of stress. It is the first time ALDH2, which is involved in many common metabolic processes in cells of all types, has been shown to play a role in cell survival. In particular, ALDH2 activity, or the lack of it, influences whether a cell enters a state of programmed cell death called apoptosis in response to stressful growing conditions. [...]

The use of heart muscle cells derived from iPS cells has opened important doors for scientists because tissue samples can be easily obtained and maintained in the laboratory for study. Until recently, researchers had to confine their studies to genetically engineered mice or to human heart cells obtained through a heart biopsy, an invasive procedure that yields cells which are difficult to keep alive long term in the laboratory.

You’ve likely read about Wu’s previous work with heart muscle cells derived from iPS cells. Now he’s shown iPS cells are also a good way to compare the effect of genetic differences among populations, and he has big plans. More details about his plans from our release:

Wu is working to start a biobank at the Stanford Cardiovascular Institute of iPS cells from about 1,000 people of many different ethnic backgrounds and health histories. “This is one of my main priorities,” he said. “For example, in California, we boast one of the most diverse populations on Earth. We’d like to include male and female patients of major representative ethnicities, age ranges and cardiovascular histories. This will allow us to conduct ‘clinical trials in a dish’ on these cells, a very powerful new approach, to learn which therapies work best for each group. This would help physicians to understand for the first time disease process at a population level through observing these cells as surrogates.”

Previously: Induced pluripotent stem cell mysteries explored by Stanford researchers, A new era for stem cells in cardiac medicine? A simple, effective way to generate patient-specific heart muscle cells and “Clinical trial in a dish” may make common medicines safer, say Stanford scientists

Photo by Nicholas Raymond

Genetics, Pediatrics, Stanford News, Surgery, Transplants

Double kidney transplants leave Hawaii siblings raring to go

Double kidney transplants leave Hawaii siblings raring to go

kidney patients

Two kids; two cases of a rare, often fatal disease; and now, thanks to the work of Lucile Packard Children’s Hospital doctors, two growing kids.

Both Julia Faisca, nearly 10, and Dominic Faisca, 8, suffer from cystinosis, a genetic disease that causes an amino acid — cystine — to build up in the kidney, eye and other places in the body.

The condition retarded the siblings’ growth, and damaged their kidneys. And by May 2013, Julia’s kidneys needed to be replaced. Fortunately, just three months later, she had a new kidney. And the Faisca family received the good news that a kidney was waiting for Dominic while they were flying to California from their home in Hawaii for a routine checkup for Julia.

“We’ve been busy — two kidney transplants in less than a year,” the kids’ mom, Natasha, said in a recent Inside Stanford Medicine story:

“Since their transplants, they aren’t picky eaters anymore,” Natasha said. “I joke with the doctors that the kids are eating me out of the house now. But it’s well worth it.”

Although they’ll always be on medication to protect their new kidneys and will need to return for twice-yearly checkups at Stanford, there’s finally a sparkle in their eyes, Natasha said.

“Dominic and Julia are growing like weeds and it’s really fun to watch them turn into regular kids,” said pediatric transplant specialist Paul Grimm, MD.

Both transplants were conducted by Waldo Concepcion, MD, a specialist in multi-organ transplantation.

Becky Bach is a science-writing intern with the Office of Communications and Public Affairs.

Previously: Baby born with rare, often-fatal kidney disease “doing well” at Packard Children’s Hospital, Contact sports OK for kids with one kidney, new study says and “Delivering hope” at Packard Children’s Hospital
Photo by Norbert von der Groeben

Applied Biotechnology, Bioengineering, Genetics, Research, Stanford News

A computer kit could lead to better way to design synthetic molecules

A computer kit could lead to better way to design synthetic molecules

SmolkeSlipping something small into cells to regulate gene expression has long been a goal of biomedical researchers. And there have been many efforts to do just that. Usually researchers concoct a teeny strip of microRNA, or miRNA, and hope it does the trick.

But now, researchers at Stanford’s Department of Bioengineering have developed a computer model to take the guesswork out of designing miRNA. The model determines how to assemble a molecule so it will measure the level of a certain compound in a cell and then use that information to regulate the expression of a gene.

The research is featured in the current edition of Nature Methods, and senior author Christina Smolke, PhD, describes the process in a release issued this week:

“You start with an idea of what you want to do in the cell, and then you build and iterate on a design over and over until you reach something close to what you want,” Smolke said. “As we design and build more sophisticated systems, we will want the ability to efficiently achieve precise quantitative behaviors, and being able to accurately predict relationships between the system inputs and outputs are important to achieving this goal.”

She and Smolke’s team — which includes former graduate student Ryan Bloom and former undergraduate Sally Winkler —tested the model on the well-known Wnt signaling pathway, which plays a key role in embryonic development, stem cell production and cancer. The synthesized miRNA correctly monitored the protein produced by the pathway, validating their model.

Becky Bach is a former park ranger who now spends her time writing about science or practicing yoga. She’s a science writing intern in the Office of Communications and Public Affairs. 

Previously: A non-surgical test for brain cancer?, From plant to pill: Bioengineers aim to produce opium-based medicines without using poppies, Researchers engineer biological “devices” to program cells
Photo of Smolke by L.A. Cicero

Stanford Medicine Resources: