Published by
Stanford Medicine

Category

Genetics

Biomed Bites, Cancer, Dermatology, Genetics, Research, Videos

Spotting broken DNA – in the DNA fix-it shop

Spotting broken DNA - in the DNA fix-it shop

It’s Thursday. And here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces Scope readers to innovators in a variety of disciplines.

Neon green streaks across the screen. The phrases “End mismatched ligation” and “Repair of DNA double-strand breaks” flash at me. Did I stumble across an online, genetic fix-it shop? Sort of -  in that Stanford biochemist Gilbert Chu, MD, PhD, studies broken DNA and has a website to match.

Chu describes his research in the video above: “We started out in the lab trying to understand and recognize DNA that’s been damaged by ultraviolet radiation, which causes skin cancer. This led to the discovery of a protein that turned out to be missing in patients with a very rare disease called xeroderma pigmentosum.”

XP afflicts about 1 in 1,000,000 people in the United States. Without the protein Chu mentioned, mutations and damage accumulates in sufferers DNA, causes cancers and extreme sensitivity to the sun.

Chu’s team has also developed methods that allow other researchers to examine the expression of genes across an entire genome and to determine which cancer patients might be harmed by treatment with ionizing radiation.

“The reason I got interested in this research is that as a member of the Department of Medicine, I am an oncologist and I’m very interested in trying to help cancer patients,” Chu said.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Skin cancer linked to UV-caused mutation in new oncogene, say Stanford researchers, Radiation therapy may attact circulating cancer cells, according to new Stanford study and How ultraviolet radiation changes the protective functions of human skin

Genetics, Pediatrics, Research, Science, Stanford News

Move over CRISPR, there’s a new editor in town: Stanford-devised approach cures hemphilia in mice

Move over CRISPR, there's a new editor in town: Stanford-devised approach cures hemphilia in mice

A lot of attention has been paid lately to the idea of genome editing. This technique allows researchers to precisely modify an animal’s DNA to replace one version of a gene with another, or to add a working copy for a mutated gene. An approach called CRISPR/Cas9 in particular has garnered interest with its ease of use, ability to modify multiple genes, and relatively quick turnaround time when making specific strains of laboratory animals like mice for study.

Now pediatrician and geneticist Mark Kay, MD, PhD, has published  in Nature a new way to conduct genome editing that could give CRISPR a run for its money because it could be both safer and longer-lasting than other methods. As described in our press release:

The approach differs from that of other hailed techniques because it doesn’t require the co-delivery of an enzyme called an endonuclease to clip the recipient’s DNA at specific locations. It also doesn’t rely on the co-insertion of genetic “on” switches called promoters to activate the new gene’s expression.

Inclusion of endonucleases and promoters run the risk of a gamut of adverse effects in the recipient, from cancers if the promoter turns on the wrong gene in the genome to an unwanted immune response geared toward the foreign proteins. The researchers in Kay’s lab, including postdoctoral scholar and study lead author Adi Barzel, PhD, found a way around their use, and showed that it worked to enable mice with hemophilia to produce a missing blood clotting factor:

The technique devised by the researchers uses neither nucleases to cut the DNA nor a promoter to drive expression of the clotting factor gene. Instead, the researchers hitch the expression of the new gene to that of a highly expressed gene in the liver called albumin. The albumin gene makes the albumin protein, which is the most abundant protein in blood. It helps to regulate blood volume and to allow molecules that don’t easily dissolve in water to be transported in the blood.

The researchers used a modified version of a virus commonly used in gene therapy called adeno-associated virus, or AAV. In the modified version, called a viral vector, all viral genes are removed and only the therapeutic genes remain. They also relied on a biological phenomenon known as homologous recombination to insert the clotting factor gene near the albumin gene. By using a special DNA linker between the genes, the researchers were able to ensure that the clotting factor protein was made hand-in-hand with the highly expressed albumin protein.

As Kay, who is also a member of the Stanford Cancer Institute, the Stanford Child Health Research Institute and Stanford Bio X, explained, the integration of the clotting factor gene is key to the successful treatment (other clinical trials involving gene therapy for hemophilia rely on the expression of a free floating, unintegrated gene in the nucleus):

The real issue with AAV is that it’s unclear how long gene expression will last when the gene is not integrated into the genome. Infants and children, who would benefit most from treatment, are still growing, and an unintegrated gene could lose its effectiveness because it’s not copied from cell to cell. Furthermore, it’s not possible to re-administer the treatment because patients develop an immune response to AAV. But with integration we could get lifelong expression without fear of cancers or other DNA damage.

Previously: Gene “editing” could correct a host of genetic disorders, Policing the editor: Stanford scientists devise way to monitor CRISPR effectiveness and Both a doctor and a patient: Stanford physician talks about his hemophilia

Cancer, Events, Genetics, Imaging, Stanford News, Surgery, Women's Health

Don’t hide from breast cancer – facing it early is key

Don't hide from breast cancer - facing it early is key

cat_hiding-pgMy cat suffers from acute anxiety. Although she and I have lived together for more than 12 years, and the worst thing I’ve ever done to her was cut her nails, she’s terrified of me. (She’s also very smart – she runs from the sound of my car, but not my husband’s). During trips to vet, Bibs hides her eyes in the crook of my elbow.

It’s a strategy that’s only minimally effective. After all, what I can’t see, or don’t recognize, can still hurt me.

Take breast cancer. It terrifies most women. And if you don’t look for it, you won’t find it. But if you do look, and find it early, you might save your life and your breast, says Amanda Wheeler, MD, a Stanford breast surgeon. She joined other Stanford breast cancer experts at a recent public program sponsored by the Stanford Women’s Cancer Center called “The Latest Advancements in Screening and Treatment for Breast Cancer.”

“One of our biggest challenge is women are scared of breast cancer, but[we have to get] the word out that we have such great advances, we’ve just got to catch it early,” Wheeler said.

She pointed to a tiny dot on a screen. At that size, Wheeler said, breast cancer is almost 100 percent curable. She performs a small lumpectomy. If it’s a little bigger, she can still probably save the nipple.

And if the entire breast must be removed, surgeons like Rahim Nazerali, MD, come in. Nazarali explained the importance of choosing a reconstruction surgeon carefully: The doctor should be accredited by the American Society of Plastic Surgeons and have experience with microsurgery, preferably on the breast. There are different ways to remold a breast and doctors can use either a synthetic implant or a patient’s own tissue, from their abdomen, hips or thighs, Nazerali explained.

All of Wheeler and Nazerali’s artistry depends on expert imaging performed by specialists like Jafi Lipson, MD, whose message at the event was simple and encouraging.

Thanks to many new developments, mammography isn’t the only way to detect nascent breast cancers, Lipson said. Her team can employ 3-D mammography, or tomosynthesis, to reveal a layered look at a breast. And genetic screening, particularly for those with a history of breast cancer in the family, can provide the earliest warning signal of all, the breast cancer team said.

Women no longer need to hide their eyes from the risk, the experts emphasized. Women should take a peek – there’s help coping with what they may find.

Previously: Screening could slash number of breast cancer cases, The squeeze: Compression during mammography important for accurate breast cancer detection, Despite genetic advances, detection still key in breast cancer, NIH Director highlights Stanford research on breast cancer surgery choices, Breast cancer awareness: Beneath the pink packaging and Using 3-D technology to screen for breast cancer
Photo by Notigatos

Cancer, Genetics, Medicine and Society, Research, Stanford News, Women's Health

Screening could slash number of breast cancer cases

Screening could slash number of breast cancer cases

dna-163466_1280Should every newborn baby girl be genetically screened to prevent breast cancer? Obviously, that isn’t cost-effective — yet. But if it were, would it be worthwhile?

A previous study said no. But research published today in Cancer Epidemiology, Biomarkers & Prevention by Stanford researchers suggests otherwise.

Led by senior author Alice Whittemore, PhD, the team examined 86 gene variants known to increase the chances of breast cancer. They created a model that accounted for the prevalence of each variant and the associated risk of breast cancer. Each possible genome was then ranked by the likelihood of developing breast cancer within a woman’s lifetime.

“It was quite a computational feat,” Whittemore told me.

Working with Weiva Sieh, MD, PhD; Joseph Rothstein, PhD; and Valerie McGuire, PhD, the team found that the riskiest top 25 percent of gene combinations predicted 50 percent of all future breast cancers.. Those women would then have the opportunity to get regular mammograms, watch their diets and make childbearing and breast-feeding decisions with the awareness of their higher risk. Some women might even select, as Angelina Jolie did quite publicly, to have their breasts removed.

“The main takeaway message is we can be more optimistic than previously predicted about the value of genomic sequencing,” Whittemore said. “But we still have a way to go in preventing the disease.”

“Our ability to predict the probability of disease based on genetics is the starting point,” Sieh said. “If a girl knew, from birth, what her inborn risk was, she could then make more informed choices to alter her future risk by altering her lifestyle factors. We also need better screening methods and preventative interventions with fewer side effects.”

“We want to focus on those at the highest risk,” Whittemore said.

Previously: Despite genetic advances, detection still key in breast cancer, NIH Director highlights Stanford research on breast cancer surgery choices  and Breast cancer awareness: Beneath the pink packaging 
Photo by PublicDomainPictures

Biomed Bites, Genetics, Research, Stanford News, Videos

DNA architecture fascinates Stanford researcher – and dictates biological outcomes

DNA architecture fascinates Stanford researcher - and dictates biological outcomes

It’s time for the next edition of Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces Scope readers to groundbreaking researchers in a variety of disciplines. 

It’s a puzzle that would delight puzzle master Will Shortz: How do you pack 2 meters of DNA into a container (the nucleus) only .000005 meters wide? Precisely, and according to plan, it seems. Stanford biophysicist Will Greenleaf, PhD, studies the architecture of the genome, building on the knowledge that DNA’s shape effects how a gene is expressed.

In the video above, Greenleaf, now an assistant professor of genetics, explains: “The genes have to be unpacked to be expressed. The mechanics of that are really fascinating.”

Greenleaf is a physics guy, earning a PhD in applied physics at Stanford to build on his undergraduate Harvard physics degree. He has also studied computer science and chemistry, bringing all of this knowledge to bear on demystifying the structure of DNA, and its RNA offshoots. Greenleaf and his team also develop new instruments needed to measure, see and manipulate DNA structure.

This is important for many reasons, but most directly to treat chromatinopathies, or diseases caused by the improper folding or structure of DNA and its associated proteins.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Caught in the act! Fast, cheap, high-resolution, easy way to tell which genes a cell is using, “Housekeeping” protein complex mutated in about 1/5 of all human cancers, say Stanford researchers and Mob science: Video game, EteRNA, lets amateurs advance RNA research

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Genetics, In the News, Research, Science

Zebrafish: A must-have for biomedical labs

4513641306_b5b4de7979_z-2

Rats, mice and fruit flies be warned: The hippest lab critter around is a striped, little fish from South Asia called the zebrafish.

The fishies’ popularity is skyrocketing, as Susannah Locke recently wrote for Vox:

Zebrafish breed quickly, scientists can manipulate their genes easily, and the fish actually share a surprising number of similarities with humans.

As a result, researchers can study zebrafish to better understand how things like metabolism, birth defects, and even cancer work — and the results are often applicable to humans. So, for instance, it’s relatively quick and easy to test certain drugs on zebrafish. If those experiments yield promising results, the scientists can then do more targeted experiments with rodents. And then maybe, finally, with people.

Zebrafish have some unique characteristics that can be useful too: Zebrafish can regenerate heart, retina, spinal cord and fin tissue. Scientists are probing this ability to improve healing and potentially even cultivate new tissues. Their embryos are also transparent, allowing scientists to study organ development in real-time.

Scientists have grown quite masterful at manipulating their genes. As Locke writes: “Over the past five years, the cost of modifying a single gene in a zebrafish has dropped from $10,000 down to about $100.” That’s part of the reason why more than 2,000 biomedical papers are written each year using the fish.

Joseph Schech, DVM, knows these animals well:

“They’re very hardy. They’re very forgiving,” says Schech, a laboratory veterinarian in charge of roughly 200,000 zebrafish (and several other species) at the National Institutes of Health. ”They are very adaptable in the wild. They live in clear mountain streams. They live in muddy rice paddies. They can do a wide range of temperature if they have time to adapt to it.”

He’s in charge of keeping the creatures healthy in a NIH zebrafish facility that’s currently used by some 21 different laboratories. It’s one of the largest zebrafish facilities in the world — a single 78–80°F room that holds about 10,000 small tanks with a total of roughly 200,000 fish. The zebrafish eat a diet of brine shrimp grown in a nearby room and can be trained to spawn on cue.

Numerous Stanford labs use zebrafish for all sorts of research: William Talbot, PhD, is examining the development of the vertebrate nervous system; Gill Bejerano, PhD, is probing its genetics; and James Chen, PhD, is looking at its ability to regenerate tissue, to name just a few.

Previously: Researchers capture detailed three-dimensional images of cardiac dynamics in zebrafish, The importance of the zebrafish in biomedicineCellular-level video of brain activity in a zebrafish and A very small fish with very big potential
Image by Bob Jenkins

Clinical Trials, Ethics, Genetics, NIH, Pediatrics

The promise and peril of genome sequencing newborns

NICUEven though doctors and researchers have made great strides in caring for patients in the past few decades, there are still many illnesses that are difficult to diagnose, let alone treat. Among the most heartbreaking cases are those newborns who come down with mysterious illnesses that defy medical expertise. But in recent years, doctors have turned to genetic sequencing in some of these cases to identify the culprit causes of the illnesses.

Last year, the National Institutes of Health funded four pilot projects looking into the efficacy and ethics of genetic screening for otherwise inexplicable illnesses in newborns. The first of the trials will begin next week at Children’s Mercy Hospital in Kansas City, Missouri, as reported in a recent story from Nature. The trial at Children’s Mercy Hospital will focus on rapid genome sequencing with a 24-hour turn-around. Genetic sequencing normally takes weeks, but some of these infants don’t survive that long. Doctors have used similar rapid genome sequencing to diagnose an infant with cardiac defects at Lucile Packard Children’s Hospital Stanford.

Earlier this year, I had the opportunity to report on a rare genetic mutation that leads young infants to develop inflammatory bowel disease. I spoke with some parents of children with the mutation, which was identified by sequencing the children’s exome – just the protein-producing part of the genome – as part of a new project (separate from the NIH trials) at the University of Toronto in Canada. As I explain in the piece, getting a bone marrow transplant early enough can help alleviate symptoms and save the child’s life.

The parents were uniformly grateful for the sequencing technology that made it possible to understand what was causing their baby’s illness, even in cases where the child didn’t survive long after diagnosis. One mother mentioned that realizing some of the best doctors in the country didn’t know what was ailing her daughter made the experience even more frightening. After months of worried confusion about their young children’s deteriorating health, for these parents to have an answer was a relief.

But because the technique is so new, several ethical details still need clarification – which the NIH study hopes to answer. From the Nature news story:

Misha Angrist, a genomic-policy expert at Duke University in Durham, North Carolina, says that although the 24-hour genome process is impressive, it is not clear whether genomic sequencing of newborns will soon become standard practice. Many questions remain about who will pay for sequencing, who should have access to the data and how far clinicians should go in extracting genome information that is unrelated to the disease at hand. Then there is the question of how informative the process is. “I think it’s really important that we do these experiments so that we start to see what that yield is,” Angrist says.

All four teams will include an ethicist who will be responsible for dealing with questions like the ones Angrist raises. The other three trials at Boston Children’s Hospital, the University of North Carolina in Chapel Hill, and at the University of California, San Francisco are still awaiting approval from the Federal Drug Adminstration.

Previously: Stanford patient on having her genome sequenced: “This is the right thing to do for our family” When ten days = a lifetime: Rapid whole-genome sequencing helps critically ill newborn Assessing the challenges and opportunities when bringing whole-genome sequencing to the bedside Whole genome sequencing: The known knowns and the unknown unknowns
Photo by kqedquest

Cancer, Genetics, Stanford News, Videos, Women's Health

Despite genetic advances, detection still key in breast cancer

Despite genetic advances, detection still key in breast cancer

Just a few years before the launch of the first national breast cancer awareness month, I found a small lump in my left breast. I still remember the cold chill that ran through me – and stayed with me until several days later when a surgeon discovered that the lump was not a tumor. His parting words have never left me: “Remember how you’ve been feeling.” He wanted to make sure I would go on to have regular mammograms.

Spreading the word about the disease and the importance of detecting it in its early stages was – and is – the point of the national awareness campaign. In the almost 30 years since that first campaign, advances in imaging technology have enabled earlier detection of breast cancer, genome sequencing has identified some of the mysteries behind the development risk, and selecting the most effective surgery and chemotherapy is more and more of an individualized choice.

Stanford has a powerful team of physicians addressing all aspects of breast cancer science and care. On Oct. 16, breast-imaging specialist Jafi Lipson, MD, assistant professor of radiology, and breast cancer surgeon Amanda Wheeler, MD, clinical assistant professor of surgery, will give a free lecture, “The Latest Advancements in Screening and Treatment for Breast Cancer,” at the Sheraton Palo Alto. And throughout the month, Stanford Health Care will post short educational videos and infographics on a variety of breast-cancer topics, including types of breast cancer, options in surgical reconstruction, and why enduring the pain of compression in mammography is worth the effort. Today, Stanford Health Care kicks off the month with a video featuring Stanford breast cancer expert Alison Kurian, MD, explaining the role that genetics play in disease development (above).

Because one in eight women will develop breast cancer in her lifetime, I would urge all of us to keep in mind the reality of this disease – and to honor those we know who have survived, or not, by paying attention.

Previously: NIH Director highlights Stanford research on breast cancer surgery choicesBreast cancer patients are getting more bilateral mastectomies —  but not any survival benefitBreast cancer awareness: Beneath the pink packaging and At Stanford event, cancer advocate Susan Love talks about “a future with no breast cancer”

Applied Biotechnology, Genetics, In the News, Nutrition, Public Health, Research

“Frankenfoods” just like natural counterparts, health-wise (at least if you’re a farm animal)

"Frankenfoods" just like natural counterparts, health-wise (at least if you're a farm animal)

cow2More than a hundred billion farm animals have voted with their feet (or their hoofs, as the case may be). And the returns are in: Genetically modified meals are causing them zero health problems.

Many a word has been spilled in connection with the scientific investigation of crops variously referred to as “transgenic,” “bioengineered,” “genetically engineered” or “genetically modified.” In every case, what’s being referred to is an otherwise ordinary fruit, vegetable, or fiber source into which genetic material from a foreign species has been inserted for the purpose of making that crop, say, sturdier or  more drought- or herbicide- or pest-resistant.

Derided as “Frankenfoods” by critics, these crops have been accused of everything from being responsible for a very real global uptick in allergic diseases to causing cancer and autoimmune disease. But (flying in the face of the first accusation) allergic disorders are also rising in Europe, where genetically modified, or GM, crops’ usage is far less widespread than in North America. It’s the same story with autoimmune disease. And claims of a link between genetically modified crops and tumor formation have been backed by scant if any evidence; one paper making such a claim  got all the way through peer review and received a fair amount of Internet buzz before it was ignominiously retracted last year.

But a huge natural experiment to test GM crops’ safety has been underway for some time. Globally, between 70 and 90 percent of all GM foods are consumed by domesticated animals grown by farmers and ranchers. More than 95 percent of such animals – close to 10 billion of them – in the United States alone consume feed containing GM  components.

This was, of course, not the case before the advent of commercially available GM feeds in the 1990s. And U.S. law has long required scrupulous record-keeping concerning the health of animals grown for food production. This makes possible a before-and-after comparison.

In a just-published article in the Journal of Animal Science, University of California-Davis scientists performed a massive review of data available on performance and health of animals consuming feed containing GM ingredients and  products derived from them. The researchers conclude that there’s no evidence of GM products exerting negative health effects on livestock. From the study’s abstract:

Numerous experimental studies have consistently revealed that the performance and health of GE-fed animals are comparable with those fed [otherwise identical] non-[GM] crop lines. Data on livestock productivity and health were collated from publicly available sources from 1983, before the introduction of [GM] crops in 1996, and subsequently through 2011, a period with high levels of predominately [GM] animal feed. These field data sets representing over 100 billion animals following the introduction of [GM]crops did not reveal unfavorable or perturbed trends in livestock health and productivity. No study has revealed any differences in the nutritional profile of animal products derived from[GM]-fed animals.

In other words, the 100 billion GM-fed animals didn’t get sick any more frequently, or in different ways. No noticeable difference at all.

Should that surprise us? We humans are, in fact, pretty transgenic ourselves. About 5 percent of our own DNA can be traced to viruses who deposited their  genes in our genomes, leaving them behind as reminders of the viral visitations. I suppose that’s a great case against cannibalism if you fear GM foods. But I can think of other far more valid arguments to be made along those lines.

Previously: Ask Stanford Medicine: Pediatric immunologist answers your questions about food allergy research, Research shows little evidence that organic foods are more nutritional than conventional ones and Stanford study on the health benefits of organic food: What people are saying
Photo by David B. Gleason

Stanford Medicine Resources: