Published by
Stanford Medicine

Category

Research

Chronic Disease, Health Costs, Infectious Disease, Research

Despite steep price tag, use of hepatitis C drug among prisoners could save money overall

Despite steep price tag, use of hepatitis C drug among prisoners could save money overall

pills-384846_640There’s nothing free about the revolution that’s shaking up hepatitis C treatment. A slew of newer drugs, including sofosbuvir, are nearly eliminating the virus with fewer side effects than the old standbys, pegylated interferon and ribavirin, which had limited effectiveness and caused fatigue, nausea and headaches. But at a cost of $7,000 a week, it seems obvious they are more expensive.

Not necessarily, however, says Jeremy Goldhaber-Fiebert, PhD. Working with colleagues including former Stanford graduate student Shan Liu, PhD, Goldhaber-Fiebert developed a model that examines the overall costs and benefits of treating hepatitis C with sofosbuvir rather than the traditional drugs in prisons. Prisoners are more likely than those in the general population to be infected with hepatitis C, a virus that attacks the liver, because it can be transmitted through intravenous drug use and unclean tattoos.

The researchers found that the high upfront cost saves money in later years by reducing the number of liver transplants and other more invasive treatments needed. In accordance with standard practices, this  study examined the overall societal cost without accounting for the source of the money. For example, the prison system’s are more likely to spend more money upfront, although savings might be recouped by Medicaid or other private insurers several decades later. From our release:

“Overall, sofosbuvir is cost-effective in this population, though its budgetary impact and affordability present appreciable challenges,” said Goldhaber-Fiebert,who is also a faculty member at Stanford’s Center for Health Policy/Center for Primary Care and Outcomes Research, which is part of the university’s Freeman Spogli Institute for International Studies.

Goldhaber-Fiebert called hepatitis C a “public health opportunity.”

“Though often not the focus of health-policy research, HCV-infected inmates are a population that may benefit particularly from a highly effective, short-duration treatment,” he said.

The research appears in this week’s Annals of Internal Medicine.

Previously: Fortune teller: Mice with ‘humanized’ livers predict HCV drug candidate’s behavior in humans, A primer on hepatitis C and For patients with advanced hepatitis C, benefits of new drugs outweigh costs
Photo by stevepb

Patient Care, Research, Stanford News

Fewer transfusions means better patient outcomes, lower mortality

Fewer transfusions means better patient outcomes, lower mortality

blood transfusionBlood transfusion has been cited by the American Medical Association as one of the top five most overused therapies in the United States. Moreover, studies have shown that when there are fewer transfusions in a hospital setting, patients generally do better, as they’re not exposed to potential transfusion risks.

With that in mind, Stanford Health Care has made a concerted effort since 2009 to effectively reduce the number of patients who receive transfusions. Since that time, patient outcomes have improved, including lower mortality rates and length of stay in the hospital. Moreover, blood costs have been markedly reduced, a new study finds.

Between 2009 and 2013, the number of red blood cell units transfused annually at Stanford Health Care fell almost 24 percent – from 29,472 to 22,991. At the same time, mortality rates and length of stays decreased overall among hospital patients. The decline occurred despite the fact that the volume of patients receiving treatment was higher and patients came in with more complex medical problems, according to the researchers, led by Lawrence Goodnough, MD, a professor of pathology and medicine and director of the hospital’s transfusion service.

Goodnough helped implement a program that uses the hospital’s electronic medical record system to alert clinicians to blood-use guidelines and relevant medical literature whenever they request a transfusion. The physician is asked to explain the reason for the transfusion, prompting him or her to reconsider whether it is also needed. As a result, the overall percentage of patients transfused dropped from 21.9 percent in 2009 to 17 percent in 2013, the researchers reported.

The researchers more closely analyzed outcomes for 3,622 patients transfused before implementation of the system and some 10,500 patients who received transfusions after the change. In this group, mortality rates fell from 5.5 percent to 3.3 percent. Patients also spent less time in the hospital (down from 10 to 6.2 days) and were less likely to be readmitted within 30 days.

In the process, the hospital has saved some $1.62 million annually in costs over each of the four years, not including indirect costs, such as patient testing and administration of blood, the researchers calculated.

A similar 2011 study conducted at Lucile Packard Children’s Hospital Stanford found that the automated alerts saved the children’s hospital 460 unnecessary red blood cell transfusions and $165,000 in one year, while patients who needed transfusions still received them.

“For health care institutions, improved blood utilization is accompanied by improved quality of care as measured by decreased patient exposure to unnecessary red blood cell transfusions, decreased blood transfusion-related costs and improved patient outcomes,” authors of the latest study, which appears in the current issue of the journal Transfusion, concluded.

Previously: Stanford Hospital trims use of blood supplies and New issue of Stanford Medicine magazine asks, What do we know about blood?
Related: Against the flow: What’s behind the decline in blood transfusions?
Illustration by Jonathon Rosen

Applied Biotechnology, Research, Stanford News, Technology

Tiny size, big impact: Ultrasound powers miniature medical implant

Tiny size, big impact: Ultrasound powers miniature medical implant

14395-chip_newsFor years, scientists have been trying to create implantable electronic devices, but challenges related to powering such technologies has limited their success. Enter a prototype developed by Stanford engineer Amin Arbabian, PhD, and colleagues that uses ultrasound waves to operate the device and send commands.

As explained in a Stanford Report story, researchers designed the “smart chip” to use piezoelectricity, or electricity generated by pressure, as a source of power and selected ultrasound because it has been extensively, and safely, used in medical settings:

[The researchers’] approach involves beaming ultrasound at a tiny device inside the body designed to do three things: convert the incoming sound waves into electricity; process and execute medical commands; and report the completed activity via a tiny built-in radio antenna.

“We think this will enable researchers to develop a new generation of tiny implants designed for a wide array of medical applications,” said Amin Arbabian, an assistant professor of electrical engineering at Stanford.

Every time a piezoelectric structure is compressed and decompressed a small electrical charge is created. The Stanford team created pressure by aiming ultrasound waves at a tiny piece of piezoelectric material mounted on the device.

“The implant is like an electrical spring that compresses and decompresses a million times a second, providing electrical charge to the chip,” said Marcus Weber, who worked on the team with fellow graduate students Jayant Charthad and Ting Chia Chang.

The prototype is about the size of a ballpoint pen head, but the team ultimately wants to make it one-tenth that size. Arbabian and his colleagues are now working with other Stanford collaborators to shrink the device even further, specifically to develop networks of small implantable electrodes for studying brains of laboratory animals.

Previously: Miniature wireless device aids pain studies, Stanford researchers demonstrate feasibility of ultra-small, wirelessly powered cardiac device and Stanford-developed retinal prosthesis uses near-infrared light to transmit images
Photo by Arbabian Lab/Stanford School of Engineering

Dermatology, Research, Science, Stanford News, Stem Cells

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

Many stem cells live a life of monotony, biding their time until they’re needed to repair tissue damage or propel the growth of a developing embryo. But when the time is right, they must spring into action without hesitation. Like Clark Kent in a phone booth, they fling aside their former identity to become the needed skin, muscle, bone or other cell types.

Now researchers at Stanford, Harvard and the University of California-Los Angeles have learned that embryonic stem cells in mice and humans chemically tag RNA messages encoding key stem-cell genes. The tags tell the cell not to let the messages linger, but to degrade them quickly. Getting rid of those messages allows the cells to respond more nimbly to their new marching orders. As dermatology professor Howard Chang, MD, PhD, explained to me in an email:

Until now, we’ve not fully understood how RNA messages within the cell dissipate. In many cases, it was thought to be somewhat random. This research shows that embryonic stem cells actively tag RNA messages that they may later need to forget. In the absence of this mechanism, the stem cells are never able to forget they are stem cells. They are stuck and cannot become brain, heart or gut, for example.

Chang, who is a Howard Hughes Medical Institute investigator and a member of the Stanford Cancer Institute, is a co-senior author of a paper describing the research, which was published today in Cell Stem Cell. He shares senior authorship with Yi Xing, PhD, an associate professor of microbiology, immunology and molecular genetics at UCLA, and Cosmas Giallourakis, MD, an assistant professor of medicine at Harvard. Lead authorship is shared by postdoctoral scholars Pedro Batista, PhD, of Stanford, and Jinkai Wang, PhD, of UCLA; and by senior research fellow Benoit Molinie, PhD, of Harvard.

Messenger RNAs are used to convey information from the genes in a cell’s nucleus to protein-making factories in the cytoplasm. They carry the instructions necessary to assemble the hundreds of thousands of individual proteins that do the work of the cell. When, where and how long each protein is made is a carefully orchestrated process that controls the fate of the cell. For example, embryonic stem cells, which can become any cell in the body, maintain their “stemness” through the ongoing production of proteins known to confer pluripotency, a term used to describe how these cells can become any cell in the body.

Continue Reading »

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Aging, Neuroscience, Research, Stanford News, Stroke

Drug helps old brains learn new tricks, and heal

Drug helps old brains learn new tricks, and heal

shatz_news

Our brains go through remarkably flexible periods in childhood when they can form new connections in a flash and retain information at a rate that leaves adults (or at least me) both impressed and also deeply jealous.

Now neurobiologist Carla Shatz, PhD, has developed a drug that at least in mice can briefly open that window for making new connections in the adult brain. It works as a sort of decoy, tricking other molecules in the cell into binding to it rather than to the “real” protein on the neuron’s surface. Without the bound molecules, the protein on the neuron’s surface releases its brake on synapse formation.

There are still a number of hurdles to overcome before the drug could work in people. The human version of the protein she studied is slightly different than the mouse version, and she had to inject the drug directly into the mouse brain. She would need to find a way of delivering the drug as a pill before it could be useful in people.

Despite those hurdles, the possibilities are exciting. From a story I wrote on the possible uses for such a drug, which she had tested in a form of blindness in mice:

This model that the team studied in mice directly applies to forms of blindness in people. Children who are born with cataracts need to have the problem repaired while the vision processing region of the brain is still able to form new connections with the eyes. “If the damage isn’t repaired early enough then it’s extremely difficult if not impossible to recover vision,” Shatz said.

If a version of the decoy protein could work in people, then kids born with cataracts in countries with limited access to surgery could potentially have their cataracts removed later, receive a drug, and be able to see. Similarly, the window could be briefly opened to help people recover from stroke or other conditions.

Previously: How villainous substance starts wrecking synapses long before clumping into Alzheimer’s plaques, “Pruning synapses” and other strides in Alzheimer’s research
Image, which shows neurons of the visual system in mice that have formed new connections, courtesy of the Shatz lab

Cardiovascular Medicine, Men's Health, Mental Health, Research, Women's Health

Examining how mental stress on the heart affects men and women differently

Examining how mental stress on the heart affects men and women differently

stress_womanPast research has shown that stress, anger and depression can increase a person’s risk for stroke and heart attacks. Now new findings published in the Journal of the American College of Cardiology show that cardiovascular and psychological reactions to mental stress vary based on gender.

In the study (subscription required), participants with heart disease completed three mentally stressful tasks. Researchers monitored changes in their heart using echocardiography, measured blood pressure and heart rate, and took blood samples during the test and rest periods. According to a journal release:

Researchers from the Duke Heart Center found that while men had more changes in blood pressure and heart rate in response to the mental stress, more women experienced myocardial ischemia, decreased blood flow to the heart. Women also experienced increased platelet aggregation, which is the start of the formation of blood clots, more than men. The women compared with men also expressed a greater increase in negative emotions and a greater decrease in positive emotions during the mental stress tests.

“The relationship between mental stress and cardiovascular disease is well known,” said the study lead author Zainab Samad, M.D., M.H.S., assistant professor of medicine at Duke University Medical Center, Durham, North Carolina. “This study revealed that mental stress affects the cardiovascular health of men and women differently. We need to recognize this difference when evaluating and treating patients for cardiovascular disease.”

Previously: Study shows link between traffic noise, heart attack, Ask Stanford Med: Cardiologist Jennifer Tremmel responds to questions on women’s heart health and Study offers insights into how depression may harm the heart
Photo by anna gutermuth

Neuroscience, Research, Sleep, Videos

How sleep acts as a cleaning system for the brain

How sleep acts as a cleaning system for the brain

Here’s one more reason why getting a good night’s sleep is critical to your health. As neuroscientist Jeff Iliff, PhD, explains in this just released TEDMED video, the brain has a specialized waste-disposal system that’s only active when we’re slumbering. Watch the talk above to learn how this system clears the brain of toxic metabolic byproducts that could lead to Alzheimer’s disease and other neurological disorders.

Previously: Why sleeping in on the weekends may not be beneficial to your health, The high price of interrupted sleep on your health and Examining how sleep quality and duration affect cognitive function as we age

In the News, Microbiology, Public Health, Research

The end of antibiotics? Researchers warn of critical shortages

The end of antibiotics? Researchers warn of critical shortages

16869_lores

Bacteria spark infection. Antibiotic kills most bacteria. Remaining bacteria evolve resistance. Second antibiotic wipes out all bacteria. Repeat. Repeat until, that is, there are no effective antibiotics, a scenario that looks increasingly likely, according to recent research from the Center for Molecular Discovery at Yale University led by Michael Kinch, PhD. Kinch now leads the Center for Research Innovation in Business at Washington University in St. Louis, which featured his work in a recent article:

The number of antibiotics available for clinical use, Kinch said, has declined to 96 from a peak of 113 in 2000. The rate of withdrawals is double the rate of new introductions, Kinch said. Antibiotics are being withdrawn because they don’t work anymore, because they’re too toxic, or because they’ve been replaced by new versions of the same drug. Introductions are declining because pharmaceutical companies are leaving the business of antibiotic use discovery and development.

Many of the major players like Pfizer, Eli Lilly, AstraZeneca and Bristol-Myers Squibb are no longer developing antibiotics, Kinch wrote in a recent article in Drug Discovery Today. In part, their disinterest is driven by a tight profit window. The drug approval process takes about 11 years, but a patent only provides 20 years of protection, leaving just nine years to recoup development costs, according to Kinch.

As outlined in the Washington University piece, at least two major initiatives are working to reverse this trend. The Infectious Diseases Society of America introduced the 10 x ’20 Initiative to spur efforts to create 10 new antibiotics by 2010. And Britain is sponsoring the Longitude Prize 2014, a £10 million award for a simple test that will quickly determine the type of bacteria causing an infection and therefore the most effective antibiotic.

Previously: Healthy gut bacteria help chicken producers avoid antibiotics, Free online course aims to education about “pressing public health threat” of antibiotic resistance and Side effects of long-term antibiotic use linked to oxidative stress
Photo by CDC Public Health Image Library

Cancer, Clinical Trials, Research, Science, Stanford News, Stem Cells

Drug may prevent bladder cancer progression, say Stanford researchers

Drug may prevent bladder cancer progression, say Stanford researchers

Bladder cancer is an insidious foe. About 70 percent of the time the condition is diagnosed while still confined to the bladder lining (in these cases, it’s known as a “carcinoma in situ,” or CIS). However, a subset of these localized cancers will go on to invade tissue surrounding the bladder and become much more deadly.

Now, developmental biologist Philip Beachy, PhD, a Howard Hughes Medical Institute investigator, and his colleagues have found that low doses of a drug called FK506 currently used to prevent the rejection of transplanted organs can prevent the progression of CIS into invasive bladder cancer in mice. Beachy collaborated with collaborated with urologist Joseph Liao, MD, and pulmonary specialist Edda Spiekerkoetter, MD, to conduct the research, which was published today in Cancer Cell. As Beachy explains in our release:

This could be a boon to the management of bladder cancer patients. Bladder cancer is the most expensive cancer to treat per patient because most patients require continual monitoring. The effective prevention of progression to invasive carcinoma would be a major advance in the treatment of this disease.

Beachy and Liao are members of the Stanford Cancer Institute. Together they’re hoping to initiate clinical trials of FK506 in people with CIS to learn whether the drug can also prevent progression to invasive cancer in humans.

The findings of the current study build upon previous research into the disease in Beachy’s laboratory and a long-time interest by Beachy in a molecular signaling pathway governed by a protein called sonic hedgehog. Beachy identified the first hedgehog protein in 1992; the protein (and the hedgehog pathway) have since been shown to play a vital role in embryonic developments and many types of cancers. Sonic hedgehog, Beachy has found, is produced by specialized stem cells in the bladder as a way to communicate with neighboring cells. They learned it’s required for the formation of CIS, but that it must also be lost in order for the cancer cells to invade other tissues. As Beachy explained in our release:

This was a very provocative finding. It was clear that these [sonic-hedgehog-expressing] bladder stem cells were the source of the intermediate cancers, or carcinomas in situ, that remain confined to the bladder lining. However, it was equally clear that sonic hedgehog expression must then be lost in order for those cancer cells to be able to invade surrounding tissue. We wondered whether the loss of this expression leads to increased tumor cell growth.

The researchers found that sonic hedgehog expression works in a loop with another class of proteins called BMPs. (You can read more about this in our release.) FK506 works by activating the BMP portion of the pathway in the absence of sonic hedgehog. Ten out of ten mice with CIS who received a low dose of the drug (low enough not to cause immunosuppression) were protected from developing invasive bladder cancer after five months of exposure to the carcinogen. In contrast, seven of nine mice receiving a placebo did develop the invasive form of the disease within the same time period.

Continue Reading »

Stanford Medicine Resources: