Published by
Stanford Medicine

Category

Research

Dermatology, Research, Science, Stanford News, Stem Cells

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

Many stem cells live a life of monotony, biding their time until they’re needed to repair tissue damage or propel the growth of a developing embryo. But when the time is right, they must spring into action without hesitation. Like Clark Kent in a phone booth, they fling aside their former identity to become the needed skin, muscle, bone or other cell types.

Now researchers at Stanford, Harvard and the University of California-Los Angeles have learned that embryonic stem cells in mice and humans chemically tag RNA messages encoding key stem-cell genes. The tags tell the cell not to let the messages linger, but to degrade them quickly. Getting rid of those messages allows the cells to respond more nimbly to their new marching orders. As dermatology professor Howard Chang, MD, PhD, explained to me in an email:

Until now, we’ve not fully understood how RNA messages within the cell dissipate. In many cases, it was thought to be somewhat random. This research shows that embryonic stem cells actively tag RNA messages that they may later need to forget. In the absence of this mechanism, the stem cells are never able to forget they are stem cells. They are stuck and cannot become brain, heart or gut, for example.

Chang, who is a Howard Hughes Medical Institute investigator and a member of the Stanford Cancer Institute, is a co-senior author of a paper describing the research, which was published today in Cell Stem Cell. He shares senior authorship with Yi Xing, PhD, an associate professor of microbiology, immunology and molecular genetics at UCLA, and Cosmas Giallourakis, MD, an assistant professor of medicine at Harvard. Lead authorship is shared by postdoctoral scholars Pedro Batista, PhD, of Stanford, and Jinkai Wang, PhD, of UCLA; and by senior research fellow Benoit Molinie, PhD, of Harvard.

Messenger RNAs are used to convey information from the genes in a cell’s nucleus to protein-making factories in the cytoplasm. They carry the instructions necessary to assemble the hundreds of thousands of individual proteins that do the work of the cell. When, where and how long each protein is made is a carefully orchestrated process that controls the fate of the cell. For example, embryonic stem cells, which can become any cell in the body, maintain their “stemness” through the ongoing production of proteins known to confer pluripotency, a term used to describe how these cells can become any cell in the body.

Continue Reading »

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Aging, Neuroscience, Research, Stanford News, Stroke

Drug helps old brains learn new tricks, and heal

Drug helps old brains learn new tricks, and heal

shatz_news

Our brains go through remarkably flexible periods in childhood when they can form new connections in a flash and retain information at a rate that leaves adults (or at least me) both impressed and also deeply jealous.

Now neurobiologist Carla Shatz, PhD, has developed a drug that at least in mice can briefly open that window for making new connections in the adult brain. It works as a sort of decoy, tricking other molecules in the cell into binding to it rather than to the “real” protein on the neuron’s surface. Without the bound molecules, the protein on the neuron’s surface releases its brake on synapse formation.

There are still a number of hurdles to overcome before the drug could work in people. The human version of the protein she studied is slightly different than the mouse version, and she had to inject the drug directly into the mouse brain. She would need to find a way of delivering the drug as a pill before it could be useful in people.

Despite those hurdles, the possibilities are exciting. From a story I wrote on the possible uses for such a drug, which she had tested in a form of blindness in mice:

This model that the team studied in mice directly applies to forms of blindness in people. Children who are born with cataracts need to have the problem repaired while the vision processing region of the brain is still able to form new connections with the eyes. “If the damage isn’t repaired early enough then it’s extremely difficult if not impossible to recover vision,” Shatz said.

If a version of the decoy protein could work in people, then kids born with cataracts in countries with limited access to surgery could potentially have their cataracts removed later, receive a drug, and be able to see. Similarly, the window could be briefly opened to help people recover from stroke or other conditions.

Previously: How villainous substance starts wrecking synapses long before clumping into Alzheimer’s plaques, “Pruning synapses” and other strides in Alzheimer’s research
Image, which shows neurons of the visual system in mice that have formed new connections, courtesy of the Shatz lab

Cardiovascular Medicine, Men's Health, Mental Health, Research, Women's Health

Examining how mental stress on the heart affects men and women differently

Examining how mental stress on the heart affects men and women differently

stress_womanPast research has shown that stress, anger and depression can increase a person’s risk for stroke and heart attacks. Now new findings published in the Journal of the American College of Cardiology show that cardiovascular and psychological reactions to mental stress vary based on gender.

In the study (subscription required), participants with heart disease completed three mentally stressful tasks. Researchers monitored changes in their heart using echocardiography, measured blood pressure and heart rate, and took blood samples during the test and rest periods. According to a journal release:

Researchers from the Duke Heart Center found that while men had more changes in blood pressure and heart rate in response to the mental stress, more women experienced myocardial ischemia, decreased blood flow to the heart. Women also experienced increased platelet aggregation, which is the start of the formation of blood clots, more than men. The women compared with men also expressed a greater increase in negative emotions and a greater decrease in positive emotions during the mental stress tests.

“The relationship between mental stress and cardiovascular disease is well known,” said the study lead author Zainab Samad, M.D., M.H.S., assistant professor of medicine at Duke University Medical Center, Durham, North Carolina. “This study revealed that mental stress affects the cardiovascular health of men and women differently. We need to recognize this difference when evaluating and treating patients for cardiovascular disease.”

Previously: Study shows link between traffic noise, heart attack, Ask Stanford Med: Cardiologist Jennifer Tremmel responds to questions on women’s heart health and Study offers insights into how depression may harm the heart
Photo by anna gutermuth

Neuroscience, Research, Sleep, Videos

How sleep acts as a cleaning system for the brain

How sleep acts as a cleaning system for the brain

Here’s one more reason why getting a good night’s sleep is critical to your health. As neuroscientist Jeff Iliff, PhD, explains in this just released TEDMED video, the brain has a specialized waste-disposal system that’s only active when we’re slumbering. Watch the talk above to learn how this system clears the brain of toxic metabolic byproducts that could lead to Alzheimer’s disease and other neurological disorders.

Previously: Why sleeping in on the weekends may not be beneficial to your health, The high price of interrupted sleep on your health and Examining how sleep quality and duration affect cognitive function as we age

In the News, Microbiology, Public Health, Research

The end of antibiotics? Researchers warn of critical shortages

The end of antibiotics? Researchers warn of critical shortages

16869_lores

Bacteria spark infection. Antibiotic kills most bacteria. Remaining bacteria evolve resistance. Second antibiotic wipes out all bacteria. Repeat. Repeat until, that is, there are no effective antibiotics, a scenario that looks increasingly likely, according to recent research from the Center for Molecular Discovery at Yale University led by Michael Kinch, PhD. Kinch now leads the Center for Research Innovation in Business at Washington University in St. Louis, which featured his work in a recent article:

The number of antibiotics available for clinical use, Kinch said, has declined to 96 from a peak of 113 in 2000. The rate of withdrawals is double the rate of new introductions, Kinch said. Antibiotics are being withdrawn because they don’t work anymore, because they’re too toxic, or because they’ve been replaced by new versions of the same drug. Introductions are declining because pharmaceutical companies are leaving the business of antibiotic use discovery and development.

Many of the major players like Pfizer, Eli Lilly, AstraZeneca and Bristol-Myers Squibb are no longer developing antibiotics, Kinch wrote in a recent article in Drug Discovery Today. In part, their disinterest is driven by a tight profit window. The drug approval process takes about 11 years, but a patent only provides 20 years of protection, leaving just nine years to recoup development costs, according to Kinch.

As outlined in the Washington University piece, at least two major initiatives are working to reverse this trend. The Infectious Diseases Society of America introduced the 10 x ’20 Initiative to spur efforts to create 10 new antibiotics by 2010. And Britain is sponsoring the Longitude Prize 2014, a £10 million award for a simple test that will quickly determine the type of bacteria causing an infection and therefore the most effective antibiotic.

Previously: Healthy gut bacteria help chicken producers avoid antibiotics, Free online course aims to education about “pressing public health threat” of antibiotic resistance and Side effects of long-term antibiotic use linked to oxidative stress
Photo by CDC Public Health Image Library

Cancer, Clinical Trials, Research, Science, Stanford News, Stem Cells

Drug may prevent bladder cancer progression, say Stanford researchers

Drug may prevent bladder cancer progression, say Stanford researchers

Bladder cancer is an insidious foe. About 70 percent of the time the condition is diagnosed while still confined to the bladder lining (in these cases, it’s known as a “carcinoma in situ,” or CIS). However, a subset of these localized cancers will go on to invade tissue surrounding the bladder and become much more deadly.

Now, developmental biologist Philip Beachy, PhD, a Howard Hughes Medical Institute investigator, and his colleagues have found that low doses of a drug called FK506 currently used to prevent the rejection of transplanted organs can prevent the progression of CIS into invasive bladder cancer in mice. Beachy collaborated with collaborated with urologist Joseph Liao, MD, and pulmonary specialist Edda Spiekerkoetter, MD, to conduct the research, which was published today in Cancer Cell. As Beachy explains in our release:

This could be a boon to the management of bladder cancer patients. Bladder cancer is the most expensive cancer to treat per patient because most patients require continual monitoring. The effective prevention of progression to invasive carcinoma would be a major advance in the treatment of this disease.

Beachy and Liao are members of the Stanford Cancer Institute. Together they’re hoping to initiate clinical trials of FK506 in people with CIS to learn whether the drug can also prevent progression to invasive cancer in humans.

The findings of the current study build upon previous research into the disease in Beachy’s laboratory and a long-time interest by Beachy in a molecular signaling pathway governed by a protein called sonic hedgehog. Beachy identified the first hedgehog protein in 1992; the protein (and the hedgehog pathway) have since been shown to play a vital role in embryonic developments and many types of cancers. Sonic hedgehog, Beachy has found, is produced by specialized stem cells in the bladder as a way to communicate with neighboring cells. They learned it’s required for the formation of CIS, but that it must also be lost in order for the cancer cells to invade other tissues. As Beachy explained in our release:

This was a very provocative finding. It was clear that these [sonic-hedgehog-expressing] bladder stem cells were the source of the intermediate cancers, or carcinomas in situ, that remain confined to the bladder lining. However, it was equally clear that sonic hedgehog expression must then be lost in order for those cancer cells to be able to invade surrounding tissue. We wondered whether the loss of this expression leads to increased tumor cell growth.

The researchers found that sonic hedgehog expression works in a loop with another class of proteins called BMPs. (You can read more about this in our release.) FK506 works by activating the BMP portion of the pathway in the absence of sonic hedgehog. Ten out of ten mice with CIS who received a low dose of the drug (low enough not to cause immunosuppression) were protected from developing invasive bladder cancer after five months of exposure to the carcinogen. In contrast, seven of nine mice receiving a placebo did develop the invasive form of the disease within the same time period.

Continue Reading »

Big data, Bioengineering, NIH, Research, Science Policy, Stanford News

$23 million in NIH grants to Stanford for two new big-data-crunching biomedical centers

$23 million in NIH grants to Stanford for two new big-data-crunching biomedical centers

More than $23 million in grants from the National Institutes of Health – courtesy of the NIH’s Big Data to Knowledge (BD2K) initiative – have launched two Stanford-housed centers of excellence bent on enhancing scientists’ capacity to compare, contrast and combine study results in order to draw more accurate conclusions, develop superior medical therapies and understand human behaviors.

Huge volumes of biomedical data – some of it from carefully controlled laboratory studies, increasing amounts of it in the form of electronic health records, and a building torrent of data from wearable sensors – languish in isolated locations and, even when researchers can get their hands on them, are about as comparable as oranges and orangutans. These gigantic banks of data, all too often, go unused or at least underused.

But maybe not for long. “The proliferation of devices monitoring human activity, including mobile phones and an ever-growing array of wearable sensors, is generating unprecedented quantities of data describing human movement, behaviors and health,” says movement-disorders expert Scott Delp, PhD, director of the new National Center for Mobility Data Integration to Insight, also known as the Mobilize Center. “With the insights gained from subjecting these massive amounts of data to  state-of-the-art analytical techniques, we hope to enhance mobility across a broad segment of the population,” Delp told me.

Directing the second grant recipient, the Center for Expanded Data and Retrieval (or CEDAR), is Stanford’s Mark Musen, MD, PhD, a world-class biomedical-computation authority. As I wrote in an online story:

[CEDAR] will address the need to standardize descriptions of diverse biomedical laboratory studies and create metadata templates for detailing the content and context of those studies. Metadata consists of descriptions of how, when and by whom a particular set of data was collected; what the study was about; how the data are formatted; and what previous or subsequent studies along similar lines have been undertaken.

The ultimate goal is to concoct a way to translate the banter of oranges and orangutans, artichokes and aardvarks now residing in a global zoo (or is it a garden?) of diverse databases into one big happy family speaking the same universal language, for the benefit of all.

Previously: NIH associate director for data science on the importance of “data to the biomedicine enterprise”, Miniature wireless device aids pain studies and Stanford bioengineers aim to better understand, treat movement disorders

Humor, otolaryngology, Research, Stanford News

Pigs to the rescue: How salt pork stops nose bleeds

Pigs to the rescue: How salt pork stops nose bleeds

pig-214349_640With all the talk this week of Nobel Prizes, another recent prize won by a Stanford physician escaped notice. To secure this prize for inventive research in medicine, Stanford otolaryngologist Ian Humphreys, MD, didn’t need access to laboratories packed with MRIs and supercomputers or a team of never-sleeping postdocs. His experimental design couldn’t be called elegant or complex – or perhaps even an experiment at all.

He won for simply deploying a nasal pork tampon. Yes, you read that correctly: He stuck bacon in the bleeding nose of a small girl, and took home the 2014 IgNobel Prize in Medicine.

“We are squealing with pride,” Robert Jackler, MD, chair of Stanford otolaryngology department, wrote to me. “We only wish that the work for which he is so deservedly honored was actually done at Stanford, but we would not want to hog the glory [from] a distinguished university in Michigan.”

Oh, dear. Before your eyes glaze over with bad-piggy puns, here’s the thing: The nasal tampon worked — twice.

Humphreys was working with a team at Michigan State University when a 4-year-old girl came into the Children’s Hospital of Michigan with a bloody nose. The girl had a rare platelet bleeding disorder called Glanzmann thrombasthenia, which can cause fatal internal and nasal bleeding and bruising. To treat her nosebleed, the doctors applied pressure, gave her a clotting protein and sent her home.

She returned the next day, “a pale, ill-appearing child in moderate distress… with brisk bleeding” from the nose, according to the winning paper, “Nasal packing with strips of cured pork as treatment for uncontrollable epistaxis in a patient with Glanzmann thrombasthenia” from the Annals of Otology, Rhinology and Laryngology.

The team whisked her into surgery and inserted  a specialized dressing to control the bleeding. Two days later, however, the bleeding started again. The girl received a transfusion and they continued monitoring her. They took her back in surgery the next day, applying another type of packing material and a coagulating serum. They also gave another dose of coagulating proteins and a red blood transfusion. She remained intubated to allow her nasal cavity to heal.

Two days later, when doctors began to remove the packing material, bleeding began immediately. Quickly, they reapplied the high-tech gauze and upped her dose of coagulation protein. She remained hospitalized, sedated. Five days later, the team again tried to remove the packing. Again, the nosebleed returned.

“At this time, strips of cured salt pork were placed in both nasal vaults,” Humphreys and his colleagues wrote. Three days later, “the bleeding was significantly less evident than it had been on all previous postoperative evaluations.” Go pork!

About a month later, the little girl fell on her face, again causing a nose bleed. This time, the team whipped out the pork right away – bye, bye nosebleed.

It turns out this isn’t the first time salt pork has been used to control a nosebleed. “It’s a traditional therapy for hard to treat bleeding disorders,” Jackler told me. “When I was a resident in the 1980s, we would buy a lump of salt pork to use.”

The salt-packed pork is thought to work by inducing swelling, thereby blocking the bleeding blood vessel.

“It is not ignorant, even though they deem it ignoble,” Jackler said.

Previously: Ten-year-old YouTube star: Famous for her singing, not for her illness, Stanford physicians and engineers showcase innovative health-care solutions and Stanford chair of otolaryngology discusses future regenerative therapies for hearing loss
Photo by Mutinka

Bioengineering, Biomed Bites, Neuroscience, Research, Videos

Deciphering “three pounds of goo” with Stanford neurobiologist Bill Newsome

Deciphering "three pounds of goo" with Stanford neurobiologist Bill Newsome

Thursday means it’s time for Biomed Bites, a weekly feature that highlights some of Stanford’s most compelling research and introduces readers to innovative scientists from a variety of disciplines. If you aren’t hooked on this series yet, you will be after hearing from this neuroscientist.

Stanford neurobiologist Bill Newsome, PhD, doesn’t invent new drugs, develop creative treatments or diagnose mysterious afflictions. He mostly uses moving dots to study vision. So it makes sense that even Newsome’s own mother asks the point of his research.

Newsome, who directs the Stanford Neuroscience Institute, fields the question with grace in the video above:

I  am interested in the brain as a biological organ that gives rise to intelligence. We study vision because we believe it’s going to give us certain cues how the brain actually works and understanding the mechanisms by which the brain produces behavior will help us understand all kinds of diseases of the brain… how thought and decision-making and memory and attention go wrong in diseases like schizophrenia, in diseases like depression.

It’s not about the dots. It’s about deciphering the brain, which Newsome calls “three pounds of goo” by gesturing toward his own goo-container. (It’s a well-known goo-container: Newsome also co-chairs the federal BRAIN Initiative). How does what you see influence what you do? What you think? What you don’t see?

Newsome has spent more than 40 years poking around in the brain and he knows it works much better than any of our most advanced attempts to replicate it. Think of all the applications for a machine that can not only see, but can also make decisions based on what it spots. But now, Newsome says, the best artificial intelligence vision systems are only as perceptive as a fly or an ant.

The notion is that if we can understand how real biological vision works, we can build artificial intelligence systems that can do vision much, much better than our current ones can… and we can improve our lives in many ways.

Basic bio it is, and basically very important.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Even old brains can stay healthy, says Stanford neurologist, Marked improvement in transplant success on the way, says Stanford immunologist and Discover the rhythms of life with a Stanford biologist

Stanford Medicine Resources: