Published by
Stanford Medicine

Applied Biotechnology, Research, Stanford News, Technology

Tiny size, big impact: Ultrasound powers miniature medical implant

Tiny size, big impact: Ultrasound powers miniature medical implant

14395-chip_newsFor years, scientists have been trying to create implantable electronic devices, but challenges related to powering such technologies has limited their success. Enter a prototype developed by Stanford engineer Amin Arbabian, PhD, and colleagues that uses ultrasound waves to operate the device and send commands.

As explained in a Stanford Report story, researchers designed the “smart chip” to use piezoelectricity, or electricity generated by pressure, as a source of power and selected ultrasound because it has been extensively, and safely, used in medical settings:

[The researchers’] approach involves beaming ultrasound at a tiny device inside the body designed to do three things: convert the incoming sound waves into electricity; process and execute medical commands; and report the completed activity via a tiny built-in radio antenna.

“We think this will enable researchers to develop a new generation of tiny implants designed for a wide array of medical applications,” said Amin Arbabian, an assistant professor of electrical engineering at Stanford.

Every time a piezoelectric structure is compressed and decompressed a small electrical charge is created. The Stanford team created pressure by aiming ultrasound waves at a tiny piece of piezoelectric material mounted on the device.

“The implant is like an electrical spring that compresses and decompresses a million times a second, providing electrical charge to the chip,” said Marcus Weber, who worked on the team with fellow graduate students Jayant Charthad and Ting Chia Chang.

The prototype is about the size of a ballpoint pen head, but the team ultimately wants to make it one-tenth that size. Arbabian and his colleagues are now working with other Stanford collaborators to shrink the device even further, specifically to develop networks of small implantable electrodes for studying brains of laboratory animals.

Previously: Miniature wireless device aids pain studies, Stanford researchers demonstrate feasibility of ultra-small, wirelessly powered cardiac device and Stanford-developed retinal prosthesis uses near-infrared light to transmit images
Photo by Arbabian Lab/Stanford School of Engineering

Dermatology, Research, Science, Stanford News, Stem Cells

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

Many stem cells live a life of monotony, biding their time until they’re needed to repair tissue damage or propel the growth of a developing embryo. But when the time is right, they must spring into action without hesitation. Like Clark Kent in a phone booth, they fling aside their former identity to become the needed skin, muscle, bone or other cell types.

Now researchers at Stanford, Harvard and the University of California-Los Angeles have learned that embryonic stem cells in mice and humans chemically tag RNA messages encoding key stem-cell genes. The tags tell the cell not to let the messages linger, but to degrade them quickly. Getting rid of those messages allows the cells to respond more nimbly to their new marching orders. As dermatology professor Howard Chang, MD, PhD, explained to me in an email:

Until now, we’ve not fully understood how RNA messages within the cell dissipate. In many cases, it was thought to be somewhat random. This research shows that embryonic stem cells actively tag RNA messages that they may later need to forget. In the absence of this mechanism, the stem cells are never able to forget they are stem cells. They are stuck and cannot become brain, heart or gut, for example.

Chang, who is a Howard Hughes Medical Institute investigator and a member of the Stanford Cancer Institute, is a co-senior author of a paper describing the research, which was published today in Cell Stem Cell. He shares senior authorship with Yi Xing, PhD, an associate professor of microbiology, immunology and molecular genetics at UCLA, and Cosmas Giallourakis, MD, an assistant professor of medicine at Harvard. Lead authorship is shared by postdoctoral scholars Pedro Batista, PhD, of Stanford, and Jinkai Wang, PhD, of UCLA; and by senior research fellow Benoit Molinie, PhD, of Harvard.

Messenger RNAs are used to convey information from the genes in a cell’s nucleus to protein-making factories in the cytoplasm. They carry the instructions necessary to assemble the hundreds of thousands of individual proteins that do the work of the cell. When, where and how long each protein is made is a carefully orchestrated process that controls the fate of the cell. For example, embryonic stem cells, which can become any cell in the body, maintain their “stemness” through the ongoing production of proteins known to confer pluripotency, a term used to describe how these cells can become any cell in the body.

Continue Reading »

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Aging, Health and Fitness, History, Neuroscience

Walking and aging: A historical perspective

Walk on by_flickrThe evidence that exercise helps stave off mental decline in elderly people has been mounting for several years now, but an article by Wayne Curtis in The Atlantic today puts this research in perspective by looking back a century at Edward Payson Weston’s walk from San Francisco to New York in 1909, when Weston was 70.

Curtis notes that the field of gerontology, the study of aging, had been around for less than a decade at that point. Most scientists thought brain cells were not capable of regenerating – something we know today that they’re most definitely capable of – and doctors were of the mind that too-vigorous exercise could harm mental acuity. Popular reaction to Weston’s trek is documented through newspaper accounts of the day:

A column in the Dallas Morning News admitted that many considered Weston’s walk from ocean to ocean “foolishness” and “an idle waste of time.” But, the writer asked, was it “preferred to the needless senility into which far too many men begin to drift at the period of three score years and 10?”

Curtis eventually moves into recent decades and details some of the recent research into how moderate to vigorous walking can actually improve mental acuity in several populations, including Alzheimer’s patients:

The results [of one long-term study], published in the journal Neurology, were sweeping and conclusive: Those who walked the most cut in half their risk of developing memory problems. The optimal exercise for cognitive health benefits, the 
researchers concluded, was to walk six to nine miles each week. That’s a mile to a mile and a half a day, without walking on Sundays if you’re inclined to follow Weston’s example of resting on the Sabbath. (This study concluded that walking an additional mile didn’t help all that much.)

I have to admit I’m glad I live in this century and not in Weston’s time. I don’t think I have the fortitude he showed in bucking popular opinion – or, to be honest, in walking.

Previously: Even old brains can stay healthy, says Stanford neurologistExercise and your brain: Stanford research highlighted on NIH Director’s blog and The state of Alzheimer’s research: A conversation with Stanford neurologist Michael Greicius
Photo by  Stefano Corso

Aging, Neuroscience, Research, Stanford News, Stroke

Drug helps old brains learn new tricks, and heal

Drug helps old brains learn new tricks, and heal

shatz_news

Our brains go through remarkably flexible periods in childhood when they can form new connections in a flash and retain information at a rate that leaves adults (or at least me) both impressed and also deeply jealous.

Now neurobiologist Carla Shatz, PhD, has developed a drug that at least in mice can briefly open that window for making new connections in the adult brain. It works as a sort of decoy, tricking other molecules in the cell into binding to it rather than to the “real” protein on the neuron’s surface. Without the bound molecules, the protein on the neuron’s surface releases its brake on synapse formation.

There are still a number of hurdles to overcome before the drug could work in people. The human version of the protein she studied is slightly different than the mouse version, and she had to inject the drug directly into the mouse brain. She would need to find a way of delivering the drug as a pill before it could be useful in people.

Despite those hurdles, the possibilities are exciting. From a story I wrote on the possible uses for such a drug, which she had tested in a form of blindness in mice:

This model that the team studied in mice directly applies to forms of blindness in people. Children who are born with cataracts need to have the problem repaired while the vision processing region of the brain is still able to form new connections with the eyes. “If the damage isn’t repaired early enough then it’s extremely difficult if not impossible to recover vision,” Shatz said.

If a version of the decoy protein could work in people, then kids born with cataracts in countries with limited access to surgery could potentially have their cataracts removed later, receive a drug, and be able to see. Similarly, the window could be briefly opened to help people recover from stroke or other conditions.

Previously: How villainous substance starts wrecking synapses long before clumping into Alzheimer’s plaques, “Pruning synapses” and other strides in Alzheimer’s research
Image, which shows neurons of the visual system in mice that have formed new connections, courtesy of the Shatz lab

Cancer, Stanford News, Videos, Women's Health

The squeeze: Compression during mammography important for accurate breast cancer detection

The squeeze: Compression during mammography important for accurate breast cancer detection

After nearly 30 years of reluctantly enduring the pain of mammography, I finally understand why I shouldn’t complain. In fact, I think I should embrace the pain and ask the technician to squeeze my breasts even more tightly between the shelves of the mammography machine.

It’s only a brief moment of pain, after all, but it can make the difference between a breast cancer detected and a breast cancer missed. In a recent video on the topic, Stanford Health Care’s Jafi Lipson, MD, an assistant professor of radiology, explains the very important reasons for women to step up and take the squeeze without complaint. It will only take 30 seconds of your time – and it might save your life.

Previously: Despite genetic advances, detection still key in breast cancer, NIH Director highlights Stanford research on breast cancer surgery choices and Breast cancer patients are getting more bilateral mastectomies — but not any survival benefit

Obesity, Pediatrics, Public Health, SMS Unplugged

When the wheels on the bus (don’t) go round: Driving the spread of local health programs

When the wheels on the bus (don't) go round: Driving the spread of local health programs

SMS (“Stanford Medical School”) Unplugged is a forum for students to chronicle their experiences in medical school. The student-penned entries appear on Scope once a week; the entire blog series can be found in the SMS Unplugged category.

family-outing-421653_640

A few years ago, I was doing a summer internship in which I looked at health outcomes for hospitalized patients. I sat in an office and read about patients with issues like high blood pressure and cholesterol. At a certain point, I realized that the reports on their outcomes were interesting, but the real solution to the problems I was studying was happening outside my window. My window overlooked a park, where kids would run around all day until they were exhausted. And it got me thinking that if all kids were as active as those ones, there would a lot fewer reports for me to read.

So last year, I worked with several medical and law students to design a county-level childhood obesity prevention policy. The need for such programs is self-explanatory: More than one third of children in the U.S. are overweight or obese. By the time people reach adulthood, that proportion goes up to two thirds. By creating a team of both medical and law students, we hoped to come up with approaches that achieved the goal of improving health, and did so in a practical and implementable way.

Over the course of several months, we analyzed dozens of programs that have been used to bring down childhood obesity rates in various communities across the country. The programs ranged from well-known approaches (e.g. a soda tax or menu calorie counts) to some more obscure ones. My personal favorite was the “Walking School Bus” (WSB). Think about how your parents used to tell you that things were tougher in their day when they had to walk to school (in the snow, going uphill, barefoot, etc.). The goal of a WSB is to bring that world back. The catch is that parents/adults walk along a predetermined “bus” route, pick up kids along the way, and then walk them to school. Kids get a supervised walk that allows them to get some exercise every day.

Case studies, and one meta-analysis, suggest that WSBs are an effective way to increase the amount of exercise kids get. But odds are, you’ve never heard about them before. Neither have most school officials, local politicians, and others in a position to take action on childhood obesity. That’s because WSBs are not widely used. This realization led me to an interesting question: Which factors make a local program or intervention spread to other communities? What does it take to turn a single success story into a widespread strategy?

These are hardly new questions. Every business or non-profit that plans to scale up considers it. Atul Gawande, MD, attempted to figure out why certain medical interventions spread in a New Yorker article last year. Whether you’re talking about social programs, technology, or just an idea, the question remains. I don’t pretend to have the answer, but my work reviewing obesity prevention policies did lead me to a few conclusions about the spread of local programs.

First, success is necessary but not sufficient for a program’s spread. Just because it proves to be successful does not mean anyone else will adopt it. WSBs were one example. Granted, WSBs are not adaptable to every community – they require schools to be within walking distance and rely on good weather. But the same story is true for other approaches. For instance, joint-use agreements are a strategy where schools open up their facilities (e.g. outdoor fields, basketball courts, etc.) after school hours to give children and families access to recreational space. Despite a correlation between these agreements and better health outcomes, they remain in limited use in many of the communities where recreational space is most lacking.

So if success doesn’t lead to a program’s spread, what does? I believe one factor is the involvement and enthusiasm of multiple stakeholders, potentially including local government, businesses, school administrators, and involved community members. A second factor is the development of measurable and achievable goals. It is nearly impossible to see incremental changes in health outcomes, so programs designed to change health must establish metrics that can demonstrate progress.

The list of lessons from our survey of local programs goes on, but the biggest takeaway is clear. Problems in health care require not only a solution, but successful execution.

Akhilesh Pathipati is a second-year medical student at Stanford. He is interested in issues in health-care delivery.

Image by EME

Immunology, In the News, Parenting, Pediatrics

Ivy and Bean help encourage kids to get vaccinated

Ivy and Bean help encourage kids to get vaccinated

Ivy and Bean2Last week, I took my two little boys to get their shots, including the MMR vaccine that protects against measles, mumps and rubella. Although, as a mom, it’s easy for me to understand the value of vaccines, I’m not sure my preschooler was completely convinced that getting poked in the arm was a great idea.

That’s why I am thrilled to see “Ivy and Bean vs. The Measles,” a set of posters and other educational materials that Sophie Blackall, the illustrator of the popular series of children’s books, has produced in collaboration with the Measles and Rubella Initiative. Blackall’s illustrations show Bean, one of the book’s two heroines, devising a series of unconventional strategies for avoiding the measles: wear a biohazard suit for the rest of your life, get adopted by a polar bear, or (my personal favorite) cover yourself in a 6-inch protective layer of lard.

“Or,” says Ivy, “get vaccinated!”

My son would probably be most interested in Bean’s suggestion to “Move to the moon!” He loves all things outer space-related, and I love the idea of finding something at our doctor’s office that would spark his interest and help me explain to him why he needs that brief poke in the arm.

Bravo, Ivy and Bean!

Via Shots
Previously: Side effects of childhood vaccines are extremely rare, new study finds, Measles is disappearing from the Western hemisphere and Tips for parents on back-to-school vaccinations
Artwork by Sophie Blackall

Cardiovascular Medicine, Men's Health, Mental Health, Research, Women's Health

Examining how mental stress on the heart affects men and women differently

Examining how mental stress on the heart affects men and women differently

stress_womanPast research has shown that stress, anger and depression can increase a person’s risk for stroke and heart attacks. Now new findings published in the Journal of the American College of Cardiology show that cardiovascular and psychological reactions to mental stress vary based on gender.

In the study (subscription required), participants with heart disease completed three mentally stressful tasks. Researchers monitored changes in their heart using echocardiography, measured blood pressure and heart rate, and took blood samples during the test and rest periods. According to a journal release:

Researchers from the Duke Heart Center found that while men had more changes in blood pressure and heart rate in response to the mental stress, more women experienced myocardial ischemia, decreased blood flow to the heart. Women also experienced increased platelet aggregation, which is the start of the formation of blood clots, more than men. The women compared with men also expressed a greater increase in negative emotions and a greater decrease in positive emotions during the mental stress tests.

“The relationship between mental stress and cardiovascular disease is well known,” said the study lead author Zainab Samad, M.D., M.H.S., assistant professor of medicine at Duke University Medical Center, Durham, North Carolina. “This study revealed that mental stress affects the cardiovascular health of men and women differently. We need to recognize this difference when evaluating and treating patients for cardiovascular disease.”

Previously: Study shows link between traffic noise, heart attack, Ask Stanford Med: Cardiologist Jennifer Tremmel responds to questions on women’s heart health and Study offers insights into how depression may harm the heart
Photo by anna gutermuth

Ebola, Global Health, Infectious Disease, Patient Care, Stanford News, Surgery

How to keep safe while operating on Ebola patients

How to keep safe while operating on Ebola patients

surgical instrumentsAmid the Ebola crisis, two U.S. surgeons with a combined 30 years of working in developing countries have stepped forward to help disseminate well-defined protocols for operating on any patient with the virus or at-risk of having contracting the virus.

In an op-ed piece published today in the San Jose Mercury News, the two surgeons first ask, then answer, their own question: “Why should anyone care about surgery and Ebola? Ebola is a virus.” Their answer is that patients still have accidents. They still need things like appendectomies and C-sections and treatment for gunshot wounds.

The piece points to shocking news reports like those of 16-year-old Shacki Kamara, a patient in Sierra Leone who died of gunshot wounds to his leg during the Ebola quarantine of West Point, Liberia because people were afraid to operate on him. The growing fear of operating on anyone suspected of having contracted the Ebola virus, which is transmitted by bodily fluids, is a flashback to the early days of the AIDS crisis when operating room personnel and physicians often declined to treat patients, said Stanford surgeon Sherry Wren, MD, who co-authored the op-ed with Johns Hopkins surgeon Adam L. Kushner, MD, founder and director of Surgeons OverSeas. The two wrote:

With supportive medical care, patients may survive an Ebola infection. Without surgery for severe trauma, obstructed labor, a strangulated hernia, or a perforated ulcer, some patients may die. The moral dilemma is overwhelming. How does one operate on a patient infected with Ebola, yet at the same time protect the surgical staff?

Last week, the two came together to write an Ebola surgery protocol and send it to a number of surgical organizations, and the largest one – the American College of Surgeons – immediately accepted and posted it on their website. The response to the new guidelines was immediate and overwhelming, Wren said. In Africa, 10 countries have since adopted the protocol. Press articles on the guidelines have also appeared around the world, including in the New York Times and Washington Post and on Al Jazeera. Wren told me in a phone interview that she was both a bit surprised and overwhelmed by the reaction:

I’ll tell you, it was amazing. I’ve seen very few things in surgery go that fast. There was a need to start the discussion. It was never my intent to be the definitive Ebola expert. I’ve never seen a case of Ebola in my life. We expanded existing  CDC guidelines for prevention of transmission of other infections such as HIV and hepatitis and then added common sense from years of  experience operating.

Both Wren and Kushner acknowledged the “unsung heroes” who bravely choose to treat Ebola patients and stress the importance of working to keep them as safe as possible by increasing the availability of supplies of protective gear especially in West Africa and working toward increased training for health care workers. As they state in their op-ed:

 The management of Ebola is new to many clinicians in the United States and elsewhere. We hope to see more training, protocols and personal protective supplies to lower risks to surgical staff and patients. Just as surgery is a necessary part of a functioning health system, surgery must be part of the discussion during this time of Ebola; otherwise, the death toll will not only include those unfortunate to have died from the virus but also those unlucky to have developed a treatable surgical condition in this time of Ebola.

Previously: Experience from the trenches in the first Ebola outbreak, Ebola: A look at what happened and what can be done, Paul Farmer: We should be saving Ebola patients, Ebola panel says 1.3 million cases possible, building trust key to containment and Should we worry? Stanford’s global health chief weighs in on Ebola
Photo by Badly Drawn Dad

Stanford Medicine Resources: