Here's this week's Biomed Bites, a weekly feature that highlights some of Stanford's most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.
Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the "noise."
That's where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer's disease.
Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn't part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she's back. For good, we hope.
Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.
Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”
