Published by
Stanford Medicine

Grand Roundup

Grand Roundup: Week of Oct. 12

Grand Roundup: Week of Oct. 12

The five most-read stories this week on Scope were:

Walking and aging: A historical perspective: An article in The Atlantic this week offered details on recent research into how moderate to vigorous walking can improve mental acuity in aging populations.

How to keep safe while operating on Ebola patients: Two U.S. surgeons with a combined 30 years of working in developing countries have prepared and disseminated well-defined protocols for operating on any patient with the virus or at-risk of having contracting the virus. Stanford surgeon Sherry Wren, MD, and her collaborator discuss this in a San Jose Mercury News op-ed piece.

Healing hands: My experience being treated for bladder cancer: In this Inspire column, an anonymous cancer patient shares his experiences and expresses gratitude for those “whose healing hands, both literally and figuratively, reached out to help me.”

Summer’s child: Stanford researchers use season of birth to estimate cancer risk: Partnering with Lund University, researchers here are using Sweden’s national registries for birth certificates and medical records to track how factors during gestation and soon after birth – called perinatal factors – affect cancer risks.

Stanford experts offer more information about enterovirus-D68: In this Q&A, Yvonne Maldonado, MD, service chief of pediatric infectious disease at Lucile Packard Children’s Hospital Stanford, and Keith Van Haren, MD, a pediatric neurologist, discuss the enterovirus-D68 respiratory illness and neurologic symptoms that might be associated with it.

And still going strong – the most popular post from the past:

Researchers explain how “cooling glove” can improve exercise recovery and performance: The “cooling glove,” a device that helps people cool themselves quickly by using their hand to dissipate heat, was created more than a decade ago by Stanford biologists Dennis Grahn and Craig Heller, PhD. This video demonstrates the device and explains how it can be used to dramatically improve exercise recovery and performance.

 

Stanford News

Weathering heights: Crane operator makes the climb for hospital expansion

image_0.img.320.highMeet  A.J. Barker, second-generation crane operator extraordinaire, who’s currently working on the new Lucile Packard Children’s Hospital Stanford from 16 stories in the air.

In a Stanford Medicine News article, Barker described his workday:

“You have to pay attention at all times,” he said. “There’s no room for error when you are flying iron and sending a load weighing thousands of pounds over to guys who are standing five stories high on beams that are 8 inches wide.”

After climbing up to the cabin, Barker starts each shift with a safety inspection of the equipment on the counter-jib behind the cabin, eyeballing the hoist cable for signs of stress, lubricating the moving parts, and checking the tension on the tower section’s bolts and lattice. He’ll go over the plans with the signalmen for safety and efficiency, and discuss options for flying the loads. The crane operates in all weather, except in very high wind or lightning storms.

Then he stays there for eight to nine hours, “flying iron” at the directions of folks on the ground. Barker, 36, learned from his dad, mastering the basics by the time he was 10. It’s a blend of physics, communication and a lack of fear of heights. “I have the coolest office view, and it changes all the time,” Barker said.

He’s proud to work on the Packard expansion, to construct a building designed to help children and families.

I never knew a person operated cranes from high in the sky. Now, thanks to Barker, I can chat about jib length and admire skilled gingerbread placement.

Previously: A trip down memory lane: Stories from the early days of the School of Medicine. Image of the Week: Digging in at the Stanford Hospital & Clinics groundbreaking and A new chapter for Stanford Hospital 
Photo by L.A. Cicero

History, Medicine and Society, NIH, Public Health

“Don’t go to bed with a malaria mosquito:” exploring World War II medical posters

"Don't go to bed with a malaria mosquito:" exploring World War II medical posters

After exploring Stanford’s collection of historical medical images last week after a tour of the School of Medicine, I got hooked. Hooked on historical medical images — a quirky interest tailor-made for the internet. Turns out the National Institutes of Health’s U.S. National Library of Medicine maintains a massive image library, one that includes some fabulous propaganda posters from World War II, including the lady mosquito with the alluring proboscis (above).

Others in the World War II poster collection focus on venereal diseases, recruiting nurses and doctors, encouraging blood donations and even curbing noise or visiting the dentist.

And that’s just World War II posters. Its Flickr collection is tantalizing, kicking off with a series of medical oddities reminiscent of Philadelphia’s Mütter Museum. It’s quite addictive – just warning you.

Previously: A trip down memory lane: Stories from the early days of the School of Medicine, #ACT4NIH seeks stories to spur research investment and Examining the impact of psychological distress on soldiers’ spinal injuries
Images courtesy of U.S National Library of Medicine

Ebola, In the News, Myths, Science

The slippery slope toward “a dangerous dependence on facts”

The slippery slope toward "a dangerous dependence on facts"

220px-Sputnik_asmThe ever-funny Andy Borowitz has written in The New Yorker about a previously unreported challenge in the fight against Ebola: It might make Americans believe in science. He writes:

In interviews conducted across the nation, leading anti-science activists expressed their concern that the American people, wracked with anxiety over the possible spread of the virus, might desperately look to science to save the day.

“It’s a very human reaction,” said Harland Dorrinson, a prominent anti-science activist from Springfield, Missouri. “If you put them under enough stress, perfectly rational people will panic and start believing in science.”

For someone who left science to become a writer specifically to help explain science to the public, this piece is both funny and also so very not funny at the same time. Almost 20 years after I put down my pipette, Americans are, if anything, less willing to let science guide their health, energy, or environmental decisions than they were back when I started – thus the humor in Borowitz’ piece.

All of this makes me wonder if I could have spared myself several decades of worrying about clever analogies, agonizing about transitions, and racing the clock to make deadlines and done something less stressful with my life. Something fulfilling. Something where at the end of the day, my work would help people live happier, healthier lives rather than producing something people will ignore if it doesn’t fit their ideology.

Matthew Nisbet and Dietram Scheufele have written a number of articles about science communication and its effects on public perception of science. In the American Journal of Botony they write, “Often when the relationship between science and society breaks down, science illiteracy is typically blamed, the absence of quality science coverage is bemoaned, and there is a call put out for ‘more Carl Sagans.’”

In a nutshell, that sums up my career switch. I bemoaned the absence of quality science coverage and fully intended to fill that gap.

Then, they go on to shatter my reasons for writing by pointing out that at a period of time when the public’s regard for science was at it’s highest – soon after the Sputnik launch – science literacy was abysmal. In one survey at the time, just 12 percent of people understood the scientific method, yet 90 percent of people believed that science was making their lives better.

What that survey suggests is that even a scientific challenge like Ebola is unlikely to push Americans to be better educated about science. But perhaps with the perfect transition, or really outstanding analogy, those same scientifically illiterate Americans can be convinced that science is making life better and – I’m really dreaming here -should be funded?

If yes, maybe Borowitz’ fictional anti-science advocate will be proved right, and we will head down that slippery slope “in which a belief in science leads to a belief in math, which in turn fosters a dangerous dependence on facts.” One can hope!

Previously: Scientist: Just because someone’s on TV doesn’t mean they’re an expert

Aging, Neuroscience, Stanford News, Stroke, Videos

Stanford expert responds to questions about brain repair and the future of neuroscience

Stanford expert responds to questions about brain repair and the future of neuroscience

One cool thing about being at Stanford is access to really, really smart people. Case in point, I get to work with William Newsome, PhD, who, in addition to doing really interesting neuroscience research, co-leads the group that made recommendations to the national BRAIN Initiative, and also directs the new Stanford Neurosciences Institute. He has a lot of insight into the state of neuroscience, where the field is headed, and what challenges scientists face in trying to better understand the brain and develop new therapies.

Newsome recently participated in an Open Office Hours, in which Stanford faculty take questions through Facebook, essentially opening their office doors to anyone with questions. He later recorded answers to those questions in the video above.

In addition to the full- length video, we’ve been posting short excerpts on Facebook. In this clip, Newsome discusses the dynamic nature of our brain’s connections. As he explains, the brain can switch connectivity to let us have one set of behaviors with our boss and another with our spouse.

In today’s installment, Newsome discusses efforts to repair nerves that are damaged in stroke, spinal cord injuries, traumatic brain injuries or other conditions. Stroke is of particular interest right now – the Neurosciences Institute that Newsome leads recently announced the creation of an interdisciplinary consortium at Stanford focused on stroke as one of their Big Ideas in Neuroscience.

In that segment, Newsome points out that nerves of our arms or legs, the so-called peripheral nervous system, can regrow if they get damaged. If you cut your finger, the nerves regrow. If you have a stroke or damage your spinal cord, the nerves don’t regrow. Newsome said:

What’s the difference between the central nervous system and the peripheral nervous system such that the central nervous system does not regrow most of the time yet the peripheral nervous system does? … When we get that knowledge the hope is that we’ll be able to set the conditions right for regrowth when there’s an injury and we’ll actually be able to help people recover function.

Previously: Deciphering “three pounds of goo” with Stanford neurobiologist Bill Newsome, Open Office Hours: Stanford neurobiologist taking your questions on brain research, Neuroscientists dream big, come up with ideas for prosthetics, mental health, stroke and more, Co-leader of Obama’s BRAIN Initiative to direct Stanford’s interdisciplinary neuroscience institute and Brain’s gain: Stanford neuroscientist discusses two major new initiatives

Patient Care, Research, Stanford News

Fewer transfusions means better patient outcomes, lower mortality

Fewer transfusions means better patient outcomes, lower mortality

blood transfusionBlood transfusion has been cited by the American Medical Association as one of the top five most overused therapies in the United States. Moreover, studies have shown that when there are fewer transfusions in a hospital setting, patients generally do better, as they’re not exposed to potential transfusion risks.

With that in mind, Stanford Health Care has made a concerted effort since 2009 to effectively reduce the number of patients who receive transfusions. Since that time, patient outcomes have improved, including lower mortality rates and length of stay in the hospital. Moreover, blood costs have been markedly reduced, a new study finds.

Between 2009 and 2013, the number of red blood cell units transfused annually at Stanford Health Care fell almost 24 percent – from 29,472 to 22,991. At the same time, mortality rates and length of stays decreased overall among hospital patients. The decline occurred despite the fact that the volume of patients receiving treatment was higher and patients came in with more complex medical problems, according to the researchers, led by Lawrence Goodnough, MD, a professor of pathology and medicine and director of the hospital’s transfusion service.

Goodnough helped implement a program that uses the hospital’s electronic medical record system to alert clinicians to blood-use guidelines and relevant medical literature whenever they request a transfusion. The physician is asked to explain the reason for the transfusion, prompting him or her to reconsider whether it is also needed. As a result, the overall percentage of patients transfused dropped from 21.9 percent in 2009 to 17 percent in 2013, the researchers reported.

The researchers more closely analyzed outcomes for 3,622 patients transfused before implementation of the system and some 10,500 patients who received transfusions after the change. In this group, mortality rates fell from 5.5 percent to 3.3 percent. Patients also spent less time in the hospital (down from 10 to 6.2 days) and were less likely to be readmitted within 30 days.

In the process, the hospital has saved some $1.62 million annually in costs over each of the four years, not including indirect costs, such as patient testing and administration of blood, the researchers calculated.

A similar 2011 study conducted at Lucile Packard Children’s Hospital Stanford found that the automated alerts saved the children’s hospital 460 unnecessary red blood cell transfusions and $165,000 in one year, while patients who needed transfusions still received them.

“For health care institutions, improved blood utilization is accompanied by improved quality of care as measured by decreased patient exposure to unnecessary red blood cell transfusions, decreased blood transfusion-related costs and improved patient outcomes,” authors of the latest study, which appears in the current issue of the journal Transfusion, concluded.

Previously: Stanford Hospital trims use of blood supplies and New issue of Stanford Medicine magazine asks, What do we know about blood?
Related: Against the flow: What’s behind the decline in blood transfusions?
Illustration by Jonathon Rosen

Applied Biotechnology, Research, Stanford News, Technology

Tiny size, big impact: Ultrasound powers miniature medical implant

Tiny size, big impact: Ultrasound powers miniature medical implant

14395-chip_newsFor years, scientists have been trying to create implantable electronic devices, but challenges related to powering such technologies has limited their success. Enter a prototype developed by Stanford engineer Amin Arbabian, PhD, and colleagues that uses ultrasound waves to operate the device and send commands.

As explained in a Stanford Report story, researchers designed the “smart chip” to use piezoelectricity, or electricity generated by pressure, as a source of power and selected ultrasound because it has been extensively, and safely, used in medical settings:

[The researchers’] approach involves beaming ultrasound at a tiny device inside the body designed to do three things: convert the incoming sound waves into electricity; process and execute medical commands; and report the completed activity via a tiny built-in radio antenna.

“We think this will enable researchers to develop a new generation of tiny implants designed for a wide array of medical applications,” said Amin Arbabian, an assistant professor of electrical engineering at Stanford.

Every time a piezoelectric structure is compressed and decompressed a small electrical charge is created. The Stanford team created pressure by aiming ultrasound waves at a tiny piece of piezoelectric material mounted on the device.

“The implant is like an electrical spring that compresses and decompresses a million times a second, providing electrical charge to the chip,” said Marcus Weber, who worked on the team with fellow graduate students Jayant Charthad and Ting Chia Chang.

The prototype is about the size of a ballpoint pen head, but the team ultimately wants to make it one-tenth that size. Arbabian and his colleagues are now working with other Stanford collaborators to shrink the device even further, specifically to develop networks of small implantable electrodes for studying brains of laboratory animals.

Previously: Miniature wireless device aids pain studies, Stanford researchers demonstrate feasibility of ultra-small, wirelessly powered cardiac device and Stanford-developed retinal prosthesis uses near-infrared light to transmit images
Photo by Arbabian Lab/Stanford School of Engineering

Dermatology, Research, Science, Stanford News, Stem Cells

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

The politics of destruction: Short-lived RNA helps stem cells turn on a dime

Many stem cells live a life of monotony, biding their time until they’re needed to repair tissue damage or propel the growth of a developing embryo. But when the time is right, they must spring into action without hesitation. Like Clark Kent in a phone booth, they fling aside their former identity to become the needed skin, muscle, bone or other cell types.

Now researchers at Stanford, Harvard and the University of California-Los Angeles have learned that embryonic stem cells in mice and humans chemically tag RNA messages encoding key stem-cell genes. The tags tell the cell not to let the messages linger, but to degrade them quickly. Getting rid of those messages allows the cells to respond more nimbly to their new marching orders. As dermatology professor Howard Chang, MD, PhD, explained to me in an email:

Until now, we’ve not fully understood how RNA messages within the cell dissipate. In many cases, it was thought to be somewhat random. This research shows that embryonic stem cells actively tag RNA messages that they may later need to forget. In the absence of this mechanism, the stem cells are never able to forget they are stem cells. They are stuck and cannot become brain, heart or gut, for example.

Chang, who is a Howard Hughes Medical Institute investigator and a member of the Stanford Cancer Institute, is a co-senior author of a paper describing the research, which was published today in Cell Stem Cell. He shares senior authorship with Yi Xing, PhD, an associate professor of microbiology, immunology and molecular genetics at UCLA, and Cosmas Giallourakis, MD, an assistant professor of medicine at Harvard. Lead authorship is shared by postdoctoral scholars Pedro Batista, PhD, of Stanford, and Jinkai Wang, PhD, of UCLA; and by senior research fellow Benoit Molinie, PhD, of Harvard.

Messenger RNAs are used to convey information from the genes in a cell’s nucleus to protein-making factories in the cytoplasm. They carry the instructions necessary to assemble the hundreds of thousands of individual proteins that do the work of the cell. When, where and how long each protein is made is a carefully orchestrated process that controls the fate of the cell. For example, embryonic stem cells, which can become any cell in the body, maintain their “stemness” through the ongoing production of proteins known to confer pluripotency, a term used to describe how these cells can become any cell in the body.

Continue Reading »

Big data, Biomed Bites, Genetics, Research

Making sense out of genetic gobbledygook with a Stanford biostatistician

Making sense out of genetic gobbledygook with a Stanford biostatistician

Here’s this week’s Biomed Bites, a weekly feature that highlights some of Stanford’s most innovative research and introduces readers to groundbreaking researchers in a variety of disciplines.

Imagine sequencing the genome of just one person. Translated into the letters that represent nucleotide subunits — A, G, T & C — it would take three billion letters to represent just one genome. AGTCCCCGTAGTTTCGAACTGAGGATCCCC….. Senseless, useless and messy. Now look at several hundred genomes — or try to find something specific within the “noise.”

That’s where genomic statisticians like Chiara Sabatti, PhD, come in handy. Sabatti smooshes this genetic gobbledygook into elegant formulas, emerging with important insights into the genome and particular diseases such as Alzheimer’s disease.

Growing up in Italy, Sabatti thought she might want to be a doctor. But she couldn’t part with her true love: numbers. As a graduate student at Stanford, she was delighted to discover statistical genetics. And after a stint at the University of California, Los Angeles, she’s back. For good, we hope.

Learn more about Stanford Medicine’s Biomedical Innovation Initiative and about other faculty leaders who are driving forward biomedical innovation here.

Previously: Stanford statistician Chiara Sabatti on teaching students to “ride the big data wave”

Aging, Health and Fitness, History, Neuroscience

Walking and aging: A historical perspective

Walk on by_flickrThe evidence that exercise helps stave off mental decline in elderly people has been mounting for several years now, but an article by Wayne Curtis in The Atlantic today puts this research in perspective by looking back a century at Edward Payson Weston’s walk from San Francisco to New York in 1909, when Weston was 70.

Curtis notes that the field of gerontology, the study of aging, had been around for less than a decade at that point. Most scientists thought brain cells were not capable of regenerating – something we know today that they’re most definitely capable of – and doctors were of the mind that too-vigorous exercise could harm mental acuity. Popular reaction to Weston’s trek is documented through newspaper accounts of the day:

A column in the Dallas Morning News admitted that many considered Weston’s walk from ocean to ocean “foolishness” and “an idle waste of time.” But, the writer asked, was it “preferred to the needless senility into which far too many men begin to drift at the period of three score years and 10?”

Curtis eventually moves into recent decades and details some of the recent research into how moderate to vigorous walking can actually improve mental acuity in several populations, including Alzheimer’s patients:

The results [of one long-term study], published in the journal Neurology, were sweeping and conclusive: Those who walked the most cut in half their risk of developing memory problems. The optimal exercise for cognitive health benefits, the 
researchers concluded, was to walk six to nine miles each week. That’s a mile to a mile and a half a day, without walking on Sundays if you’re inclined to follow Weston’s example of resting on the Sabbath. (This study concluded that walking an additional mile didn’t help all that much.)

I have to admit I’m glad I live in this century and not in Weston’s time. I don’t think I have the fortitude he showed in bucking popular opinion – or, to be honest, in walking.

Previously: Even old brains can stay healthy, says Stanford neurologistExercise and your brain: Stanford research highlighted on NIH Director’s blog and The state of Alzheimer’s research: A conversation with Stanford neurologist Michael Greicius
Photo by  Stefano Corso

Stanford Medicine Resources: